Incidental Mutation 'R3785:Inpp5k'
ID272224
Institutional Source Beutler Lab
Gene Symbol Inpp5k
Ensembl Gene ENSMUSG00000006127
Gene Nameinositol polyphosphate 5-phosphatase K
Synonymsputative PI-5-phosphatase, PI-5-phosphatase related, C62, Pps
MMRRC Submission 040752-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3785 (G1)
Quality Score196
Status Validated
Chromosome11
Chromosomal Location75630988-75648871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75647686 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 461 (L461P)
Ref Sequence ENSEMBL: ENSMUSP00000006286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006286] [ENSMUST00000069057] [ENSMUST00000102504] [ENSMUST00000102505] [ENSMUST00000139856] [ENSMUST00000150857]
Predicted Effect probably damaging
Transcript: ENSMUST00000006286
AA Change: L461P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006286
Gene: ENSMUSG00000006127
AA Change: L461P

DomainStartEndE-ValueType
IPPc 30 345 1.03e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069057
SMART Domains Protein: ENSMUSP00000070388
Gene: ENSMUSG00000017774

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102504
SMART Domains Protein: ENSMUSP00000099562
Gene: ENSMUSG00000017774

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102505
SMART Domains Protein: ENSMUSP00000099563
Gene: ENSMUSG00000017774

DomainStartEndE-ValueType
MYSc 40 732 N/A SMART
IQ 733 755 3.85e-3 SMART
IQ 756 778 2.09e-4 SMART
Blast:MYSc 786 815 6e-9 BLAST
low complexity region 839 850 N/A INTRINSIC
Pfam:Myosin_TH1 874 1052 2.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136605
Predicted Effect probably damaging
Transcript: ENSMUST00000139856
AA Change: L105P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121060
Gene: ENSMUSG00000006127
AA Change: L105P

DomainStartEndE-ValueType
Blast:IPPc 18 94 4e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149134
Predicted Effect probably benign
Transcript: ENSMUST00000150857
Meta Mutation Damage Score 0.1822 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 5-phosphatase activity toward polyphosphate inositol. The protein localizes to the cytosol in regions lacking actin stress fibers. It is thought that this protein may negatively regulate the actin cytoskeleton. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic lethality. Adult heterozygous mutant mice show normal food intake and adiposity but exhibit enhanced glucose homeostasis and insulin sensitivity, increased insulin action in skeletal muscle, and reduced diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
A2ml1 C T 6: 128,544,924 probably null Het
Aak1 T C 6: 86,965,578 F701S unknown Het
Arid2 T A 15: 96,372,558 D1517E possibly damaging Het
Cyp2r1 C T 7: 114,554,696 V88I possibly damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dnah11 G T 12: 118,017,602 Q2610K probably damaging Het
Gm5698 T C 1: 30,977,479 T164A probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Gpx6 A G 13: 21,313,786 T76A probably benign Het
Htra3 A T 5: 35,671,128 L136H probably benign Het
Ifitm10 G A 7: 142,328,598 T145I possibly damaging Het
Kcnd3 C A 3: 105,668,225 T555K possibly damaging Het
Kif13b C T 14: 64,800,400 T1505I probably benign Het
Mcf2l G T 8: 12,880,099 G40C probably damaging Het
Mettl3 A T 14: 52,299,906 I102N probably benign Het
Muc5b C T 7: 141,865,116 T3933I possibly damaging Het
Mus81 G A 19: 5,485,361 probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Mypn C A 10: 63,193,182 R34L probably benign Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Olfr1012 G A 2: 85,759,453 P308S probably benign Het
Olfr1305 T C 2: 111,873,486 Y123C probably damaging Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf5 A G 17: 34,601,932 probably null Het
Sacs C A 14: 61,183,961 Q116K probably damaging Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Slc13a4 T A 6: 35,287,892 T131S probably damaging Het
Slc9a4 C A 1: 40,583,970 P123Q probably damaging Het
Stxbp4 T A 11: 90,535,615 probably null Het
Swt1 T C 1: 151,379,404 D814G probably benign Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Wap G A 11: 6,638,550 Q25* probably null Het
Zfp26 A T 9: 20,437,802 C489S probably damaging Het
Zfp804b G A 5: 6,770,153 T934M possibly damaging Het
Other mutations in Inpp5k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Inpp5k APN 11 75646820 missense possibly damaging 0.72
IGL00470:Inpp5k APN 11 75645525 missense probably benign 0.00
IGL00529:Inpp5k APN 11 75631204 unclassified probably benign
IGL01761:Inpp5k APN 11 75647677 missense possibly damaging 0.75
IGL02532:Inpp5k APN 11 75633184 unclassified probably benign
R0081:Inpp5k UTSW 11 75631147 frame shift probably null
R0206:Inpp5k UTSW 11 75631143 missense probably benign
R0206:Inpp5k UTSW 11 75631143 missense probably benign
R0520:Inpp5k UTSW 11 75639530 nonsense probably null
R0841:Inpp5k UTSW 11 75633459 unclassified probably benign
R1145:Inpp5k UTSW 11 75633459 unclassified probably benign
R1433:Inpp5k UTSW 11 75637491 missense probably benign 0.00
R1605:Inpp5k UTSW 11 75633481 missense probably benign 0.00
R2144:Inpp5k UTSW 11 75647191 critical splice acceptor site probably null
R2145:Inpp5k UTSW 11 75647191 critical splice acceptor site probably null
R2296:Inpp5k UTSW 11 75639487 missense probably damaging 1.00
R3783:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R3784:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R3787:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R5999:Inpp5k UTSW 11 75633100 missense probably damaging 0.99
R6337:Inpp5k UTSW 11 75646814 missense probably damaging 1.00
R6405:Inpp5k UTSW 11 75633178 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGCAACAACCTGCACTCTG -3'
(R):5'- AGTCTAGCTGAGCTCCTCTG -3'

Sequencing Primer
(F):5'- CTCTGTAGTGGGGATAAGTCAACCC -3'
(R):5'- CCTCTGGGAGGTGGGGAG -3'
Posted On2015-03-25