Incidental Mutation 'R3785:Stxbp4'
ID272226
Institutional Source Beutler Lab
Gene Symbol Stxbp4
Ensembl Gene ENSMUSG00000020546
Gene Namesyntaxin binding protein 4
SynonymsSynip, 6030470M02Rik
MMRRC Submission 040752-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3785 (G1)
Quality Score182
Status Validated
Chromosome11
Chromosomal Location90476492-90638084 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 90535615 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020858] [ENSMUST00000143203]
Predicted Effect probably null
Transcript: ENSMUST00000020858
SMART Domains Protein: ENSMUSP00000020858
Gene: ENSMUSG00000020546

DomainStartEndE-ValueType
PDZ 29 109 6.13e-10 SMART
low complexity region 131 154 N/A INTRINSIC
coiled coil region 298 409 N/A INTRINSIC
low complexity region 504 522 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119669
Predicted Effect probably null
Transcript: ENSMUST00000123260
SMART Domains Protein: ENSMUSP00000122365
Gene: ENSMUSG00000020546

DomainStartEndE-ValueType
coiled coil region 3 42 N/A INTRINSIC
SCOP:d1i5hw_ 132 153 6e-7 SMART
Blast:WW 135 153 3e-7 BLAST
PDB:2YSG|A 136 153 4e-7 PDB
Predicted Effect probably null
Transcript: ENSMUST00000143203
SMART Domains Protein: ENSMUSP00000116191
Gene: ENSMUSG00000020546

DomainStartEndE-ValueType
PDZ 29 109 6.13e-10 SMART
low complexity region 131 154 N/A INTRINSIC
coiled coil region 298 409 N/A INTRINSIC
WW 501 533 1.11e-10 SMART
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
A2ml1 C T 6: 128,544,924 probably null Het
Aak1 T C 6: 86,965,578 F701S unknown Het
Arid2 T A 15: 96,372,558 D1517E possibly damaging Het
Cyp2r1 C T 7: 114,554,696 V88I possibly damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dnah11 G T 12: 118,017,602 Q2610K probably damaging Het
Gm5698 T C 1: 30,977,479 T164A probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Gpx6 A G 13: 21,313,786 T76A probably benign Het
Htra3 A T 5: 35,671,128 L136H probably benign Het
Ifitm10 G A 7: 142,328,598 T145I possibly damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Kcnd3 C A 3: 105,668,225 T555K possibly damaging Het
Kif13b C T 14: 64,800,400 T1505I probably benign Het
Mcf2l G T 8: 12,880,099 G40C probably damaging Het
Mettl3 A T 14: 52,299,906 I102N probably benign Het
Muc5b C T 7: 141,865,116 T3933I possibly damaging Het
Mus81 G A 19: 5,485,361 probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Mypn C A 10: 63,193,182 R34L probably benign Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Olfr1012 G A 2: 85,759,453 P308S probably benign Het
Olfr1305 T C 2: 111,873,486 Y123C probably damaging Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf5 A G 17: 34,601,932 probably null Het
Sacs C A 14: 61,183,961 Q116K probably damaging Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Slc13a4 T A 6: 35,287,892 T131S probably damaging Het
Slc9a4 C A 1: 40,583,970 P123Q probably damaging Het
Swt1 T C 1: 151,379,404 D814G probably benign Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Wap G A 11: 6,638,550 Q25* probably null Het
Zfp26 A T 9: 20,437,802 C489S probably damaging Het
Zfp804b G A 5: 6,770,153 T934M possibly damaging Het
Other mutations in Stxbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Stxbp4 APN 11 90535512 missense probably benign 0.00
IGL01312:Stxbp4 APN 11 90621649 splice site probably benign
IGL01313:Stxbp4 APN 11 90621649 splice site probably benign
IGL01314:Stxbp4 APN 11 90621649 splice site probably benign
IGL01316:Stxbp4 APN 11 90621649 splice site probably benign
IGL01377:Stxbp4 APN 11 90621649 splice site probably benign
IGL01380:Stxbp4 APN 11 90621649 splice site probably benign
IGL01385:Stxbp4 APN 11 90540248 missense possibly damaging 0.95
IGL01408:Stxbp4 APN 11 90621649 splice site probably benign
IGL02573:Stxbp4 APN 11 90540269 missense probably damaging 0.99
IGL02707:Stxbp4 APN 11 90537933 missense probably benign 0.00
IGL02809:Stxbp4 APN 11 90600184 critical splice donor site probably null
IGL02900:Stxbp4 APN 11 90607035 missense probably benign 0.03
IGL03177:Stxbp4 APN 11 90571753 missense probably benign 0.01
IGL03397:Stxbp4 APN 11 90540234 missense probably damaging 1.00
IGL02799:Stxbp4 UTSW 11 90494600 critical splice donor site probably null
IGL03134:Stxbp4 UTSW 11 90607184 missense probably damaging 0.98
R0005:Stxbp4 UTSW 11 90548917 missense possibly damaging 0.78
R0487:Stxbp4 UTSW 11 90592360 missense probably benign 0.00
R0930:Stxbp4 UTSW 11 90621700 start codon destroyed probably null 0.99
R1633:Stxbp4 UTSW 11 90540160 splice site probably benign
R4359:Stxbp4 UTSW 11 90494644 nonsense probably null
R4591:Stxbp4 UTSW 11 90594780 missense probably benign 0.33
R4756:Stxbp4 UTSW 11 90607371 missense probably damaging 1.00
R5095:Stxbp4 UTSW 11 90548975 missense probably benign 0.00
R5870:Stxbp4 UTSW 11 90537956 missense possibly damaging 0.89
R6268:Stxbp4 UTSW 11 90540201 nonsense probably null
R6460:Stxbp4 UTSW 11 90606985 missense probably benign 0.35
R6479:Stxbp4 UTSW 11 90619187 missense probably damaging 0.99
R7139:Stxbp4 UTSW 11 90607009 nonsense probably null
R7349:Stxbp4 UTSW 11 90592111 splice site probably null
R7481:Stxbp4 UTSW 11 90594813 missense possibly damaging 0.94
R7812:Stxbp4 UTSW 11 90594828 missense probably damaging 1.00
R8903:Stxbp4 UTSW 11 90535441 missense unknown
V8831:Stxbp4 UTSW 11 90480671 missense probably benign 0.34
Z1176:Stxbp4 UTSW 11 90480671 missense probably benign 0.34
Z1177:Stxbp4 UTSW 11 90480671 missense probably benign 0.34
Z1177:Stxbp4 UTSW 11 90592331 critical splice donor site probably null
Z1177:Stxbp4 UTSW 11 90600146 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAACTAAGGTCTTTCTTCTGCTTTG -3'
(R):5'- CAGTATGCTCAATGGGTGTCC -3'

Sequencing Primer
(F):5'- TTACAAGAAGAAGAGGAGGAGAAG -3'
(R):5'- TCCTGGCTGGGCAGTATGC -3'
Posted On2015-03-25