Incidental Mutation 'R3785:Gpx6'
ID272229
Institutional Source Beutler Lab
Gene Symbol Gpx6
Ensembl Gene ENSMUSG00000004341
Gene Nameglutathione peroxidase 6
Synonyms1700020G18Rik, olfactory
MMRRC Submission 040752-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3785 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21312125-21319624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21313786 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 76 (T76A)
Ref Sequence ENSEMBL: ENSMUSP00000004453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004453]
Predicted Effect probably benign
Transcript: ENSMUST00000004453
AA Change: T76A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000004453
Gene: ENSMUSG00000004341
AA Change: T76A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:GSHPx 40 153 1.2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136668
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: This gene encodes a member of the glutathione peroxidase family. Glutathione peroxidases catalyze the reduction of a variety of hydroperoxides, using glutathione as a specific electron donor substrate. The mouse and the rat orthologs contain Cys, unlike their human counterpart, which is a selenoprotein containing Sec (selenocysteine) at its active site. Expression of this gene is restricted to embryos and adult olfactory epithelium. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
A2ml1 C T 6: 128,544,924 probably null Het
Aak1 T C 6: 86,965,578 F701S unknown Het
Arid2 T A 15: 96,372,558 D1517E possibly damaging Het
Cyp2r1 C T 7: 114,554,696 V88I possibly damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dnah11 G T 12: 118,017,602 Q2610K probably damaging Het
Gm5698 T C 1: 30,977,479 T164A probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Htra3 A T 5: 35,671,128 L136H probably benign Het
Ifitm10 G A 7: 142,328,598 T145I possibly damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Kcnd3 C A 3: 105,668,225 T555K possibly damaging Het
Kif13b C T 14: 64,800,400 T1505I probably benign Het
Mcf2l G T 8: 12,880,099 G40C probably damaging Het
Mettl3 A T 14: 52,299,906 I102N probably benign Het
Muc5b C T 7: 141,865,116 T3933I possibly damaging Het
Mus81 G A 19: 5,485,361 probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Mypn C A 10: 63,193,182 R34L probably benign Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Olfr1012 G A 2: 85,759,453 P308S probably benign Het
Olfr1305 T C 2: 111,873,486 Y123C probably damaging Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf5 A G 17: 34,601,932 probably null Het
Sacs C A 14: 61,183,961 Q116K probably damaging Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Slc13a4 T A 6: 35,287,892 T131S probably damaging Het
Slc9a4 C A 1: 40,583,970 P123Q probably damaging Het
Stxbp4 T A 11: 90,535,615 probably null Het
Swt1 T C 1: 151,379,404 D814G probably benign Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Wap G A 11: 6,638,550 Q25* probably null Het
Zfp26 A T 9: 20,437,802 C489S probably damaging Het
Zfp804b G A 5: 6,770,153 T934M possibly damaging Het
Other mutations in Gpx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Gpx6 APN 13 21313808 splice site probably benign
Jaded UTSW 13 21317658 missense probably damaging 1.00
R0648:Gpx6 UTSW 13 21318877 missense probably benign 0.44
R0835:Gpx6 UTSW 13 21317068 missense probably damaging 1.00
R1496:Gpx6 UTSW 13 21318920 missense probably benign
R1538:Gpx6 UTSW 13 21313652 missense possibly damaging 0.82
R1839:Gpx6 UTSW 13 21312327 missense probably benign
R2151:Gpx6 UTSW 13 21318971 missense probably damaging 1.00
R2845:Gpx6 UTSW 13 21318875 critical splice acceptor site probably null
R3973:Gpx6 UTSW 13 21317658 missense probably damaging 1.00
R3974:Gpx6 UTSW 13 21317658 missense probably damaging 1.00
R3975:Gpx6 UTSW 13 21317658 missense probably damaging 1.00
R4124:Gpx6 UTSW 13 21317645 nonsense probably null
R4707:Gpx6 UTSW 13 21312264 nonsense probably null
R4751:Gpx6 UTSW 13 21317064 missense probably damaging 1.00
R4784:Gpx6 UTSW 13 21312264 nonsense probably null
R4785:Gpx6 UTSW 13 21312264 nonsense probably null
R5002:Gpx6 UTSW 13 21313688 missense probably damaging 1.00
R5403:Gpx6 UTSW 13 21317643 missense probably damaging 1.00
R6004:Gpx6 UTSW 13 21319069 missense probably benign
R6030:Gpx6 UTSW 13 21312340 missense probably benign 0.01
R6030:Gpx6 UTSW 13 21312340 missense probably benign 0.01
R7223:Gpx6 UTSW 13 21317670 critical splice donor site probably null
X0017:Gpx6 UTSW 13 21317039 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTCGTATCATTCTAGTACTTGTG -3'
(R):5'- TCTTGGGGAAAGCCTTGGAG -3'

Sequencing Primer
(F):5'- GTTTTATTACAGGTGGATTGCAAC -3'
(R):5'- CTCAAGCATGGAGATAGTTGTGGC -3'
Posted On2015-03-25