Incidental Mutation 'R3785:Arid2'
ID272235
Institutional Source Beutler Lab
Gene Symbol Arid2
Ensembl Gene ENSMUSG00000033237
Gene NameAT rich interactive domain 2 (ARID, RFX-like)
Synonyms4432409D24Rik, 1700124K17Rik, zipzap/p200
MMRRC Submission 040752-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3785 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location96287518-96404992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96372558 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1517 (D1517E)
Ref Sequence ENSEMBL: ENSMUSP00000093969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096250]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096250
AA Change: D1517E

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093969
Gene: ENSMUSG00000033237
AA Change: D1517E

DomainStartEndE-ValueType
ARID 10 101 9.67e-36 SMART
BRIGHT 14 106 3.67e-34 SMART
Pfam:RFX_DNA_binding 521 603 1.7e-26 PFAM
internal_repeat_1 767 843 3.29e-6 PROSPERO
low complexity region 902 942 N/A INTRINSIC
low complexity region 965 986 N/A INTRINSIC
low complexity region 1012 1054 N/A INTRINSIC
low complexity region 1118 1131 N/A INTRINSIC
internal_repeat_1 1132 1215 3.29e-6 PROSPERO
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1590 1614 N/A INTRINSIC
ZnF_C2H2 1626 1651 4.34e0 SMART
ZnF_C2H2 1659 1684 4.74e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176739
Meta Mutation Damage Score 0.0755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interactive domain (ARID)-containing family of DNA-binding proteins. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and chromatin structure modification. This protein functions as a subunit of the polybromo- and BRG1-associated factor or PBAF (SWI/SNF-B) chromatin remodeling complex which facilitates ligand-dependent transcriptional activation by nuclear receptors. Mutations in this gene are associated with hepatocellular carcinomas. A pseudogene of this gene is found on chromosome1. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E12.5 and E14.5, congenital heart defects, impaired coronary artery development, subcutaneous edema and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
A2ml1 C T 6: 128,544,924 probably null Het
Aak1 T C 6: 86,965,578 F701S unknown Het
Cyp2r1 C T 7: 114,554,696 V88I possibly damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dnah11 G T 12: 118,017,602 Q2610K probably damaging Het
Gm5698 T C 1: 30,977,479 T164A probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Gpx6 A G 13: 21,313,786 T76A probably benign Het
Htra3 A T 5: 35,671,128 L136H probably benign Het
Ifitm10 G A 7: 142,328,598 T145I possibly damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Kcnd3 C A 3: 105,668,225 T555K possibly damaging Het
Kif13b C T 14: 64,800,400 T1505I probably benign Het
Mcf2l G T 8: 12,880,099 G40C probably damaging Het
Mettl3 A T 14: 52,299,906 I102N probably benign Het
Muc5b C T 7: 141,865,116 T3933I possibly damaging Het
Mus81 G A 19: 5,485,361 probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Mypn C A 10: 63,193,182 R34L probably benign Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Olfr1012 G A 2: 85,759,453 P308S probably benign Het
Olfr1305 T C 2: 111,873,486 Y123C probably damaging Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf5 A G 17: 34,601,932 probably null Het
Sacs C A 14: 61,183,961 Q116K probably damaging Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Slc13a4 T A 6: 35,287,892 T131S probably damaging Het
Slc9a4 C A 1: 40,583,970 P123Q probably damaging Het
Stxbp4 T A 11: 90,535,615 probably null Het
Swt1 T C 1: 151,379,404 D814G probably benign Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Wap G A 11: 6,638,550 Q25* probably null Het
Zfp26 A T 9: 20,437,802 C489S probably damaging Het
Zfp804b G A 5: 6,770,153 T934M possibly damaging Het
Other mutations in Arid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Arid2 APN 15 96372302 missense probably benign
IGL00321:Arid2 APN 15 96289089 missense probably damaging 0.97
IGL00434:Arid2 APN 15 96371300 missense probably damaging 0.99
IGL00576:Arid2 APN 15 96356758 missense probably damaging 0.99
IGL00766:Arid2 APN 15 96370405 missense probably benign 0.09
IGL01563:Arid2 APN 15 96372397 missense probably damaging 0.99
IGL01697:Arid2 APN 15 96361572 critical splice acceptor site probably null
IGL01845:Arid2 APN 15 96356797 missense probably damaging 1.00
IGL02159:Arid2 APN 15 96358912 splice site probably benign
IGL02341:Arid2 APN 15 96372185 missense probably benign
IGL02416:Arid2 APN 15 96350055 missense possibly damaging 0.63
IGL02578:Arid2 APN 15 96372235 missense probably benign 0.00
IGL02598:Arid2 APN 15 96371536 missense probably damaging 1.00
IGL02644:Arid2 APN 15 96368708 missense probably damaging 1.00
IGL02653:Arid2 APN 15 96287702 missense probably damaging 0.99
IGL03115:Arid2 APN 15 96370273 missense probably damaging 1.00
IGL03137:Arid2 APN 15 96371318 missense probably benign 0.44
IGL03220:Arid2 APN 15 96361772 missense probably damaging 0.99
IGL03249:Arid2 APN 15 96401965 missense probably damaging 1.00
IGL03256:Arid2 APN 15 96370762 missense probably benign 0.18
IGL03386:Arid2 APN 15 96361574 missense probably damaging 1.00
H8562:Arid2 UTSW 15 96369546 missense possibly damaging 0.77
I2288:Arid2 UTSW 15 96369511 missense possibly damaging 0.95
R0254:Arid2 UTSW 15 96370571 missense probably damaging 0.97
R0284:Arid2 UTSW 15 96378967 splice site probably benign
R0347:Arid2 UTSW 15 96370952 missense probably benign 0.01
R0366:Arid2 UTSW 15 96361720 splice site probably benign
R0400:Arid2 UTSW 15 96356925 unclassified probably benign
R0650:Arid2 UTSW 15 96402049 missense possibly damaging 0.47
R0651:Arid2 UTSW 15 96402049 missense possibly damaging 0.47
R1034:Arid2 UTSW 15 96369505 missense probably benign 0.01
R1615:Arid2 UTSW 15 96371654 missense possibly damaging 0.59
R1696:Arid2 UTSW 15 96370183 missense probably benign 0.01
R2024:Arid2 UTSW 15 96361799 missense probably damaging 1.00
R2046:Arid2 UTSW 15 96369387 missense probably damaging 1.00
R2069:Arid2 UTSW 15 96362590 missense probably damaging 1.00
R2149:Arid2 UTSW 15 96370835 missense probably damaging 1.00
R2300:Arid2 UTSW 15 96402006 missense probably damaging 1.00
R2336:Arid2 UTSW 15 96362549 missense probably damaging 1.00
R2359:Arid2 UTSW 15 96361878 missense probably damaging 1.00
R2368:Arid2 UTSW 15 96350012 missense possibly damaging 0.83
R2829:Arid2 UTSW 15 96369454 missense possibly damaging 0.95
R3013:Arid2 UTSW 15 96361936 missense probably damaging 1.00
R3109:Arid2 UTSW 15 96356746 missense probably damaging 1.00
R3765:Arid2 UTSW 15 96370714 missense probably benign 0.01
R3811:Arid2 UTSW 15 96289086 missense probably benign 0.01
R3812:Arid2 UTSW 15 96289086 missense probably benign 0.01
R3813:Arid2 UTSW 15 96369950 missense probably benign 0.26
R3843:Arid2 UTSW 15 96351840 missense possibly damaging 0.86
R3978:Arid2 UTSW 15 96363622 missense probably damaging 1.00
R4279:Arid2 UTSW 15 96371756 missense probably damaging 1.00
R4569:Arid2 UTSW 15 96392462 missense probably damaging 1.00
R4597:Arid2 UTSW 15 96370856 missense probably damaging 1.00
R5020:Arid2 UTSW 15 96371988 missense probably damaging 0.96
R5154:Arid2 UTSW 15 96401985 missense probably damaging 1.00
R5303:Arid2 UTSW 15 96392468 missense probably damaging 1.00
R5620:Arid2 UTSW 15 96372506 missense probably benign 0.20
R5766:Arid2 UTSW 15 96372205 missense probably benign 0.01
R6005:Arid2 UTSW 15 96370972 missense probably benign
R6169:Arid2 UTSW 15 96368677 missense probably benign 0.36
R6216:Arid2 UTSW 15 96356909 missense probably benign 0.18
R6392:Arid2 UTSW 15 96361602 missense probably damaging 0.99
R6430:Arid2 UTSW 15 96363694 missense probably benign
R6454:Arid2 UTSW 15 96372413 missense probably benign 0.20
R6672:Arid2 UTSW 15 96362345 missense probably benign 0.30
R6776:Arid2 UTSW 15 96370949 missense probably benign 0.00
R6985:Arid2 UTSW 15 96370148 missense probably benign 0.06
R7132:Arid2 UTSW 15 96350013 missense possibly damaging 0.67
R7133:Arid2 UTSW 15 96378875 missense probably damaging 0.99
R7453:Arid2 UTSW 15 96370724 missense probably benign
R7562:Arid2 UTSW 15 96401968 missense probably damaging 1.00
R7594:Arid2 UTSW 15 96390994 missense probably damaging 1.00
R7692:Arid2 UTSW 15 96356697 nonsense probably null
R7792:Arid2 UTSW 15 96369375 missense probably benign 0.05
R8036:Arid2 UTSW 15 96368744 missense probably damaging 1.00
X0024:Arid2 UTSW 15 96372490 missense probably benign 0.00
X0066:Arid2 UTSW 15 96356804 missense probably damaging 1.00
Z1177:Arid2 UTSW 15 96390986 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGTTTGAATTCAGATGTGCCTC -3'
(R):5'- ACACTCTGCATGTAGGTCGG -3'

Sequencing Primer
(F):5'- CAGCAACGCCCAAGTGTAGTTG -3'
(R):5'- CATGTAGGTCGGTGGATGC -3'
Posted On2015-03-25