Incidental Mutation 'R3786:Hao2'
ID272247
Institutional Source Beutler Lab
Gene Symbol Hao2
Ensembl Gene ENSMUSG00000027870
Gene Namehydroxyacid oxidase 2
SynonymsHao3
MMRRC Submission 040753-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3786 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location98874521-98893239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98876752 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 327 (E327V)
Ref Sequence ENSEMBL: ENSMUSP00000029464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029464]
Predicted Effect probably damaging
Transcript: ENSMUST00000029464
AA Change: E327V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029464
Gene: ENSMUSG00000027870
AA Change: E327V

DomainStartEndE-ValueType
Pfam:FMN_dh 13 350 1.8e-127 PFAM
Pfam:Glu_synthase 258 314 1.1e-6 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related genes that have 2-hydroxyacid oxidase activity. The encoded protein localizes to the peroxisome has the highest activity toward the substrate 2-hydroxypalmitate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Electrophoretic variants are known for this locus in kidney. The a allele determines a slow anodally migrating band in all inbred strains tested; the b allele determines a fast band in M. m. castaneus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 T A 3: 97,159,289 L41Q probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
BC003331 A G 1: 150,384,531 I112T probably benign Het
Btbd7 C T 12: 102,838,152 E210K probably benign Het
C1qtnf12 G A 4: 155,965,899 R231H probably damaging Het
Cenpf T A 1: 189,658,337 E1099D probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Dzip3 C A 16: 48,975,543 C155F probably benign Het
Fam161b A T 12: 84,361,690 probably null Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hnrnpl A G 7: 28,811,011 probably benign Het
Itgb1 T A 8: 128,713,358 I176N probably damaging Het
Kif13b C T 14: 64,800,400 T1505I probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Mettl3 A T 14: 52,299,906 I102N probably benign Het
Mgat4c A G 10: 102,385,070 H71R probably damaging Het
Misp G A 10: 79,825,961 V71I probably benign Het
Muc2 A G 7: 141,697,347 Q734R probably benign Het
Muc5b C T 7: 141,865,116 T3933I possibly damaging Het
Myh13 A G 11: 67,327,188 N29S probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neb C A 2: 52,201,915 V5046F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nrg1 A T 8: 31,821,383 V376E probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Ppp1r21 T A 17: 88,577,127 probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Rhoc T C 3: 104,792,687 probably null Het
Robo3 A G 9: 37,422,225 V708A probably damaging Het
Rtcb G T 10: 85,942,594 T395K possibly damaging Het
Rttn A G 18: 89,037,894 T967A probably benign Het
Sacs C A 14: 61,183,961 Q116K probably damaging Het
Smarca4 A G 9: 21,672,059 H1062R possibly damaging Het
Spatc1l C T 10: 76,563,902 T86I probably benign Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tsc1 A G 2: 28,687,142 D1151G probably damaging Het
Ttll1 T C 15: 83,484,218 D413G probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Wnt16 A G 6: 22,298,022 N296D probably benign Het
Other mutations in Hao2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Hao2 APN 3 98880332 splice site probably benign
IGL03279:Hao2 APN 3 98880396 missense possibly damaging 0.88
goatherd UTSW 3 98877135 missense probably benign 0.06
R0600:Hao2 UTSW 3 98883560 splice site probably benign
R1298:Hao2 UTSW 3 98883669 missense possibly damaging 0.94
R3176:Hao2 UTSW 3 98880328 splice site probably benign
R3177:Hao2 UTSW 3 98880328 splice site probably benign
R4486:Hao2 UTSW 3 98882025 missense probably damaging 1.00
R4487:Hao2 UTSW 3 98882025 missense probably damaging 1.00
R4488:Hao2 UTSW 3 98882025 missense probably damaging 1.00
R5290:Hao2 UTSW 3 98877177 missense probably damaging 0.99
R5760:Hao2 UTSW 3 98880432 nonsense probably null
R6129:Hao2 UTSW 3 98880526 missense probably benign 0.00
R6720:Hao2 UTSW 3 98877135 missense probably benign 0.06
R6861:Hao2 UTSW 3 98877182 missense probably damaging 1.00
R6991:Hao2 UTSW 3 98876752 missense probably damaging 1.00
R7203:Hao2 UTSW 3 98877282 splice site probably null
R8277:Hao2 UTSW 3 98880384 missense probably damaging 1.00
R8515:Hao2 UTSW 3 98883647 missense probably benign 0.00
Z1088:Hao2 UTSW 3 98875352 missense probably damaging 1.00
Z1177:Hao2 UTSW 3 98881942 missense probably benign 0.02
Z1177:Hao2 UTSW 3 98882041 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGTGAGCAGTTCTTGATCTC -3'
(R):5'- AGTCCTTGACTCAGGCTTTC -3'

Sequencing Primer
(F):5'- GCAGTTCTTGATCTCTTTGTAAAAC -3'
(R):5'- GACTCAGGCTTTCCCCACTTG -3'
Posted On2015-03-25