Incidental Mutation 'R3786:Hnrnpl'
ID272255
Institutional Source Beutler Lab
Gene Symbol Hnrnpl
Ensembl Gene ENSMUSG00000015165
Gene Nameheterogeneous nuclear ribonucleoprotein L
SynonymsHnrpl, D830027H13Rik
MMRRC Submission 040753-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3786 (G1)
Quality Score137
Status Not validated
Chromosome7
Chromosomal Location28808541-28822266 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 28811011 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038572] [ENSMUST00000172529] [ENSMUST00000172884] [ENSMUST00000174548] [ENSMUST00000174882]
Predicted Effect unknown
Transcript: ENSMUST00000038572
AA Change: K34R
SMART Domains Protein: ENSMUSP00000049407
Gene: ENSMUSG00000015165
AA Change: K34R

DomainStartEndE-ValueType
low complexity region 3 57 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
RRM 100 169 9.8e-9 SMART
RRM 191 261 4.75e-7 SMART
low complexity region 314 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
RRM 380 449 5.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172529
SMART Domains Protein: ENSMUSP00000133932
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
Blast:RRM 1 39 9e-20 BLAST
RRM 61 131 4.75e-7 SMART
low complexity region 184 209 N/A INTRINSIC
low complexity region 226 244 N/A INTRINSIC
RRM 250 319 5.09e-7 SMART
Blast:RRM_2 369 442 6e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172841
Predicted Effect probably benign
Transcript: ENSMUST00000172884
SMART Domains Protein: ENSMUSP00000134271
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
Blast:RRM 1 39 1e-21 BLAST
SCOP:d1qm9a1 3 61 3e-3 SMART
Pfam:RRM_6 67 113 5.7e-5 PFAM
Pfam:RRM_1 70 113 1.3e-5 PFAM
Pfam:RRM_5 78 113 9.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174396
Predicted Effect unknown
Transcript: ENSMUST00000174477
AA Change: K25R
SMART Domains Protein: ENSMUSP00000134734
Gene: ENSMUSG00000015165
AA Change: K25R

DomainStartEndE-ValueType
low complexity region 4 49 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
RRM 92 161 9.8e-9 SMART
RRM 183 253 4.75e-7 SMART
low complexity region 339 368 N/A INTRINSIC
low complexity region 385 403 N/A INTRINSIC
RRM 409 478 5.09e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174548
AA Change: K34R
SMART Domains Protein: ENSMUSP00000133728
Gene: ENSMUSG00000015165
AA Change: K34R

DomainStartEndE-ValueType
low complexity region 3 57 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
RRM 100 169 9.8e-9 SMART
RRM 191 261 4.75e-7 SMART
low complexity region 314 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
RRM 380 449 5.09e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174755
Predicted Effect probably benign
Transcript: ENSMUST00000174882
SMART Domains Protein: ENSMUSP00000133952
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
RRM 1 61 5.18e-1 SMART
RRM 83 153 4.75e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209194
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterogeneous nuclear RNAs (hnRNAs) which include mRNA precursors and mature mRNAs are associated with specific proteins to form heterogenous ribonucleoprotein (hnRNP) complexes. Heterogeneous nuclear ribonucleoprotein L is among the proteins that are stably associated with hnRNP complexes and along with other hnRNP proteins is likely to play a major role in the formation, packaging, processing, and function of mRNA. Heterogeneous nuclear ribonucleoprotein L is present in the nucleoplasm as part of the HNRP complex. HNRP proteins have also been identified outside of the nucleoplasm. Exchange of hnRNP for mRNA-binding proteins accompanies transport of mRNA from the nucleus to the cytoplasm. Since HNRP proteins have been shown to shuttle between the nucleus and the cytoplasm, it is possible that they also have cytoplasmic functions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic letahlity after E3.5. Mice homozygous for a conditional allele activated in thymocytes exhibit decreased T cells in the periphery associated with impaired thymocyte chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 T A 3: 97,159,289 L41Q probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
BC003331 A G 1: 150,384,531 I112T probably benign Het
Btbd7 C T 12: 102,838,152 E210K probably benign Het
C1qtnf12 G A 4: 155,965,899 R231H probably damaging Het
Cenpf T A 1: 189,658,337 E1099D probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Dzip3 C A 16: 48,975,543 C155F probably benign Het
Fam161b A T 12: 84,361,690 probably null Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Hao2 T A 3: 98,876,752 E327V probably damaging Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Itgb1 T A 8: 128,713,358 I176N probably damaging Het
Kif13b C T 14: 64,800,400 T1505I probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Mettl3 A T 14: 52,299,906 I102N probably benign Het
Mgat4c A G 10: 102,385,070 H71R probably damaging Het
Misp G A 10: 79,825,961 V71I probably benign Het
Muc2 A G 7: 141,697,347 Q734R probably benign Het
Muc5b C T 7: 141,865,116 T3933I possibly damaging Het
Myh13 A G 11: 67,327,188 N29S probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neb C A 2: 52,201,915 V5046F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nrg1 A T 8: 31,821,383 V376E probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Ppp1r21 T A 17: 88,577,127 probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Rhoc T C 3: 104,792,687 probably null Het
Robo3 A G 9: 37,422,225 V708A probably damaging Het
Rtcb G T 10: 85,942,594 T395K possibly damaging Het
Rttn A G 18: 89,037,894 T967A probably benign Het
Sacs C A 14: 61,183,961 Q116K probably damaging Het
Smarca4 A G 9: 21,672,059 H1062R possibly damaging Het
Spatc1l C T 10: 76,563,902 T86I probably benign Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tsc1 A G 2: 28,687,142 D1151G probably damaging Het
Ttll1 T C 15: 83,484,218 D413G probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Wnt16 A G 6: 22,298,022 N296D probably benign Het
Other mutations in Hnrnpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Hnrnpl APN 7 28813373 missense probably damaging 1.00
IGL00783:Hnrnpl APN 7 28820642 missense probably benign 0.02
IGL00784:Hnrnpl APN 7 28820642 missense probably benign 0.02
IGL03248:Hnrnpl APN 7 28814080 missense probably benign 0.00
R0143:Hnrnpl UTSW 7 28814192 splice site probably benign
R1529:Hnrnpl UTSW 7 28813923 missense possibly damaging 0.74
R1567:Hnrnpl UTSW 7 28820183 missense possibly damaging 0.73
R4837:Hnrnpl UTSW 7 28817337 missense probably benign 0.00
R5412:Hnrnpl UTSW 7 28811104 unclassified probably benign
R6617:Hnrnpl UTSW 7 28818584 intron probably benign
R7238:Hnrnpl UTSW 7 28813975 missense
R8283:Hnrnpl UTSW 7 28814272 missense
R8336:Hnrnpl UTSW 7 28814037 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCGTCCTATCCAATAGAAATGAACC -3'
(R):5'- TCCTTCCGGGAGTCTAAAGC -3'

Sequencing Primer
(F):5'- CTATCCAATAGAAATGAACCGTGAG -3'
(R):5'- GGAGTCTAAAGCCCCAGC -3'
Posted On2015-03-25