Incidental Mutation 'R3787:Olfr61'
ID272312
Institutional Source Beutler Lab
Gene Symbol Olfr61
Ensembl Gene ENSMUSG00000096069
Gene Nameolfactory receptor 61
SynonymsMOR253-1, IH7, GA_x6K02T2PBJ9-42783826-42784758
MMRRC Submission 040754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R3787 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140628970-140638798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140637835 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 45 (V45I)
Ref Sequence ENSEMBL: ENSMUSP00000147924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084455] [ENSMUST00000210241] [ENSMUST00000210373] [ENSMUST00000211685]
Predicted Effect probably benign
Transcript: ENSMUST00000084455
AA Change: V45I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000081493
Gene: ENSMUSG00000096069
AA Change: V45I

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 3.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 175 1.3e-8 PFAM
Pfam:7tm_1 42 291 3.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210241
AA Change: V45I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000210373
Predicted Effect probably benign
Transcript: ENSMUST00000211685
AA Change: V45I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Aprt T C 8: 122,575,529 D65G probably benign Het
Auh C A 13: 52,929,457 R62L possibly damaging Het
Bmp4 C T 14: 46,385,714 probably null Het
Bptf C A 11: 107,073,827 D1514Y probably damaging Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc112 C T 18: 46,299,298 R72H probably benign Het
Ccdc138 T C 10: 58,538,270 Y371H probably damaging Het
Chsy3 T C 18: 59,408,998 Y403H probably damaging Het
Cul4a T C 8: 13,133,668 V352A probably damaging Het
D5Ertd577e T A 5: 95,482,897 L211Q probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Dmxl2 T C 9: 54,369,878 D2893G probably damaging Het
Dnah8 A G 17: 30,755,041 D2800G probably damaging Het
Dnaja2 C T 8: 85,540,386 G281R probably damaging Het
Exo1 A G 1: 175,899,469 T449A probably benign Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Fmo1 A T 1: 162,830,014 S519R possibly damaging Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Mcm9 A G 10: 53,615,980 V415A possibly damaging Het
Mki67 A T 7: 135,700,283 N1007K possibly damaging Het
Mpped1 A T 15: 83,796,583 probably benign Het
Mtpap T C 18: 4,380,670 V116A probably damaging Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nfs1 A G 2: 156,128,583 I270T possibly damaging Het
Nr1i3 A G 1: 171,214,425 D26G probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pde4dip G T 3: 97,715,552 P1447Q possibly damaging Het
Plxna2 A G 1: 194,643,934 T59A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r12c G A 7: 4,486,584 A193V probably damaging Het
Prdm15 G T 16: 97,797,745 H904Q probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Reep1 T A 6: 71,795,215 D162E probably damaging Het
Rev3l T A 10: 39,846,210 L2528Q probably damaging Het
Rfc1 A T 5: 65,296,014 S264T probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Sipa1l2 C T 8: 125,423,205 A1602T probably benign Het
Sipa1l2 C A 8: 125,450,383 C1164F possibly damaging Het
Slc4a1ap T A 5: 31,528,139 L254I possibly damaging Het
Slc5a3 A G 16: 92,077,928 N291S possibly damaging Het
Stab2 T A 10: 86,969,277 D279V possibly damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Vmn1r63 T A 7: 5,802,752 M294L probably benign Het
Vmn2r58 C T 7: 41,864,074 D382N probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Other mutations in Olfr61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Olfr61 APN 7 140638256 missense probably damaging 1.00
IGL01837:Olfr61 APN 7 140638211 missense probably damaging 1.00
IGL02349:Olfr61 APN 7 140638471 missense probably benign 0.00
IGL02713:Olfr61 APN 7 140637916 missense probably damaging 0.98
IGL02982:Olfr61 APN 7 140637952 missense probably benign 0.06
IGL03205:Olfr61 APN 7 140638160 missense possibly damaging 0.90
R1477:Olfr61 UTSW 7 140638442 missense possibly damaging 0.94
R1564:Olfr61 UTSW 7 140638054 missense probably benign 0.21
R1900:Olfr61 UTSW 7 140638592 missense probably damaging 0.99
R2149:Olfr61 UTSW 7 140638052 missense probably damaging 0.99
R2504:Olfr61 UTSW 7 140638484 missense probably benign 0.01
R2887:Olfr61 UTSW 7 140638225 missense probably damaging 1.00
R4628:Olfr61 UTSW 7 140638384 missense probably benign 0.04
R4775:Olfr61 UTSW 7 140637916 missense probably damaging 0.98
R5805:Olfr61 UTSW 7 140638471 missense probably benign 0.00
R6019:Olfr61 UTSW 7 140638012 missense probably benign 0.03
R6244:Olfr61 UTSW 7 140638433 missense probably damaging 1.00
R7303:Olfr61 UTSW 7 140638354 missense probably damaging 1.00
R7505:Olfr61 UTSW 7 140638052 missense probably damaging 1.00
R7783:Olfr61 UTSW 7 140637724 missense possibly damaging 0.86
Z1088:Olfr61 UTSW 7 140638220 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGCTCAAGGCTGGAAAC -3'
(R):5'- AAGAGCTGAGCCATGCATCC -3'

Sequencing Primer
(F):5'- CCAGACTTTGCAGTGGTAAAC -3'
(R):5'- GAGCCATGCATCCTTTGAAG -3'
Posted On2015-03-25