Incidental Mutation 'R3787:Gpt2'
ID272314
Institutional Source Beutler Lab
Gene Symbol Gpt2
Ensembl Gene ENSMUSG00000031700
Gene Nameglutamic pyruvate transaminase (alanine aminotransferase) 2
SynonymsALT2, 4631422C05Rik
MMRRC Submission 040754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R3787 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85492576-85527560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85525573 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 506 (V506L)
Ref Sequence ENSEMBL: ENSMUSP00000034136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034136] [ENSMUST00000132932]
Predicted Effect probably benign
Transcript: ENSMUST00000034136
AA Change: V506L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034136
Gene: ENSMUSG00000031700
AA Change: V506L

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Pfam:Aminotran_1_2 110 510 6.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132932
SMART Domains Protein: ENSMUSP00000115968
Gene: ENSMUSG00000031700

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
PDB:3IHJ|A 48 148 6e-63 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143846
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial alanine transaminase, a pyridoxal enzyme that catalyzes the reversible transamination between alanine and 2-oxoglutarate to generate pyruvate and glutamate. Alanine transaminases play roles in gluconeogenesis and amino acid metabolism in many tissues including skeletal muscle, kidney, and liver. Activating transcription factor 4 upregulates this gene under metabolic stress conditions in hepatocyte cell lines. A loss of function mutation in this gene has been associated with developmental encephalopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity, reduced postnatal brain growth, various metabolic defects in pathways involving amino acid metabolism, the TCA cycle and neuroprotective mechanisms, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Aprt T C 8: 122,575,529 D65G probably benign Het
Auh C A 13: 52,929,457 R62L possibly damaging Het
Bmp4 C T 14: 46,385,714 probably null Het
Bptf C A 11: 107,073,827 D1514Y probably damaging Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc112 C T 18: 46,299,298 R72H probably benign Het
Ccdc138 T C 10: 58,538,270 Y371H probably damaging Het
Chsy3 T C 18: 59,408,998 Y403H probably damaging Het
Cul4a T C 8: 13,133,668 V352A probably damaging Het
D5Ertd577e T A 5: 95,482,897 L211Q probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Dmxl2 T C 9: 54,369,878 D2893G probably damaging Het
Dnah8 A G 17: 30,755,041 D2800G probably damaging Het
Dnaja2 C T 8: 85,540,386 G281R probably damaging Het
Exo1 A G 1: 175,899,469 T449A probably benign Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Fmo1 A T 1: 162,830,014 S519R possibly damaging Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Mcm9 A G 10: 53,615,980 V415A possibly damaging Het
Mki67 A T 7: 135,700,283 N1007K possibly damaging Het
Mpped1 A T 15: 83,796,583 probably benign Het
Mtpap T C 18: 4,380,670 V116A probably damaging Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nfs1 A G 2: 156,128,583 I270T possibly damaging Het
Nr1i3 A G 1: 171,214,425 D26G probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfr61 G A 7: 140,637,835 V45I probably benign Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pde4dip G T 3: 97,715,552 P1447Q possibly damaging Het
Plxna2 A G 1: 194,643,934 T59A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r12c G A 7: 4,486,584 A193V probably damaging Het
Prdm15 G T 16: 97,797,745 H904Q probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Reep1 T A 6: 71,795,215 D162E probably damaging Het
Rev3l T A 10: 39,846,210 L2528Q probably damaging Het
Rfc1 A T 5: 65,296,014 S264T probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Sipa1l2 C T 8: 125,423,205 A1602T probably benign Het
Sipa1l2 C A 8: 125,450,383 C1164F possibly damaging Het
Slc4a1ap T A 5: 31,528,139 L254I possibly damaging Het
Slc5a3 A G 16: 92,077,928 N291S possibly damaging Het
Stab2 T A 10: 86,969,277 D279V possibly damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Vmn1r63 T A 7: 5,802,752 M294L probably benign Het
Vmn2r58 C T 7: 41,864,074 D382N probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Other mutations in Gpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Gpt2 APN 8 85512324 missense probably benign
IGL01611:Gpt2 APN 8 85519538 nonsense probably null
IGL02385:Gpt2 APN 8 85516153 splice site probably null
IGL02484:Gpt2 APN 8 85516233 missense probably damaging 1.00
IGL02589:Gpt2 APN 8 85516166 nonsense probably null
IGL02669:Gpt2 APN 8 85523279 missense probably benign 0.02
R1191:Gpt2 UTSW 8 85509272 missense probably damaging 1.00
R1599:Gpt2 UTSW 8 85512234 missense probably damaging 1.00
R1944:Gpt2 UTSW 8 85517996 missense probably damaging 1.00
R1953:Gpt2 UTSW 8 85521384 missense probably benign 0.00
R1962:Gpt2 UTSW 8 85493135 missense probably damaging 0.99
R1982:Gpt2 UTSW 8 85516203 missense possibly damaging 0.75
R2283:Gpt2 UTSW 8 85516189 missense probably benign
R3785:Gpt2 UTSW 8 85525573 missense probably benign
R3786:Gpt2 UTSW 8 85525573 missense probably benign
R4402:Gpt2 UTSW 8 85525559 missense probably benign 0.32
R4974:Gpt2 UTSW 8 85519439 splice site probably benign
R5457:Gpt2 UTSW 8 85512338 missense possibly damaging 0.90
R5589:Gpt2 UTSW 8 85493111 missense probably damaging 1.00
R5734:Gpt2 UTSW 8 85523256 missense probably benign 0.17
R5924:Gpt2 UTSW 8 85493004 missense probably damaging 1.00
R6371:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6651:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6652:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6895:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6898:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6923:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6955:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6956:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7112:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7113:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7115:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7124:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7125:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7327:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7486:Gpt2 UTSW 8 85525606 missense probably damaging 0.98
R7582:Gpt2 UTSW 8 85519516 missense probably damaging 1.00
X0058:Gpt2 UTSW 8 85518019 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GGTGACTCAGAATCTGGTTTATTGC -3'
(R):5'- GCAAAACCACTGTTTGCTCG -3'

Sequencing Primer
(F):5'- CAGAATCTGGTTTATTGCTTTCCG -3'
(R):5'- CCACTGTTTGCTCGAAGAAC -3'
Posted On2015-03-25