Incidental Mutation 'R3787:Dnaja2'
ID272315
Institutional Source Beutler Lab
Gene Symbol Dnaja2
Ensembl Gene ENSMUSG00000031701
Gene NameDnaJ heat shock protein family (Hsp40) member A2
Synonyms2010206B19Rik, mDj3, HIRIP4, 1500017M13Rik, PRO3015, DNJ3
MMRRC Submission 040754-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.688) question?
Stock #R3787 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85537633-85555344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85540386 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 281 (G281R)
Ref Sequence ENSEMBL: ENSMUSP00000034138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034138]
Predicted Effect probably damaging
Transcript: ENSMUST00000034138
AA Change: G281R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034138
Gene: ENSMUSG00000031701
AA Change: G281R

DomainStartEndE-ValueType
DnaJ 7 62 8.53e-31 SMART
low complexity region 70 83 N/A INTRINSIC
low complexity region 101 113 N/A INTRINSIC
Pfam:DnaJ_C 116 338 8.5e-36 PFAM
Pfam:DnaJ_CXXCXGXG 143 209 3.4e-18 PFAM
low complexity region 393 403 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain. The product of this gene works as a cochaperone of Hsp70s in protein folding and mitochondrial protein import in vitro. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Aprt T C 8: 122,575,529 D65G probably benign Het
Auh C A 13: 52,929,457 R62L possibly damaging Het
Bmp4 C T 14: 46,385,714 probably null Het
Bptf C A 11: 107,073,827 D1514Y probably damaging Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc112 C T 18: 46,299,298 R72H probably benign Het
Ccdc138 T C 10: 58,538,270 Y371H probably damaging Het
Chsy3 T C 18: 59,408,998 Y403H probably damaging Het
Cul4a T C 8: 13,133,668 V352A probably damaging Het
D5Ertd577e T A 5: 95,482,897 L211Q probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Dmxl2 T C 9: 54,369,878 D2893G probably damaging Het
Dnah8 A G 17: 30,755,041 D2800G probably damaging Het
Exo1 A G 1: 175,899,469 T449A probably benign Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Fmo1 A T 1: 162,830,014 S519R possibly damaging Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Mcm9 A G 10: 53,615,980 V415A possibly damaging Het
Mki67 A T 7: 135,700,283 N1007K possibly damaging Het
Mpped1 A T 15: 83,796,583 probably benign Het
Mtpap T C 18: 4,380,670 V116A probably damaging Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nfs1 A G 2: 156,128,583 I270T possibly damaging Het
Nr1i3 A G 1: 171,214,425 D26G probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfr61 G A 7: 140,637,835 V45I probably benign Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pde4dip G T 3: 97,715,552 P1447Q possibly damaging Het
Plxna2 A G 1: 194,643,934 T59A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r12c G A 7: 4,486,584 A193V probably damaging Het
Prdm15 G T 16: 97,797,745 H904Q probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Reep1 T A 6: 71,795,215 D162E probably damaging Het
Rev3l T A 10: 39,846,210 L2528Q probably damaging Het
Rfc1 A T 5: 65,296,014 S264T probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Sipa1l2 C T 8: 125,423,205 A1602T probably benign Het
Sipa1l2 C A 8: 125,450,383 C1164F possibly damaging Het
Slc4a1ap T A 5: 31,528,139 L254I possibly damaging Het
Slc5a3 A G 16: 92,077,928 N291S possibly damaging Het
Stab2 T A 10: 86,969,277 D279V possibly damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Vmn1r63 T A 7: 5,802,752 M294L probably benign Het
Vmn2r58 C T 7: 41,864,074 D382N probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Other mutations in Dnaja2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Dnaja2 APN 8 85555237 missense probably damaging 0.98
IGL01479:Dnaja2 APN 8 85553951 missense probably damaging 1.00
IGL01722:Dnaja2 APN 8 85553279 missense probably benign 0.35
IGL01946:Dnaja2 APN 8 85546700 missense probably damaging 1.00
IGL03310:Dnaja2 APN 8 85548905 missense probably benign 0.00
R0689:Dnaja2 UTSW 8 85546718 splice site probably benign
R1350:Dnaja2 UTSW 8 85540088 missense probably damaging 1.00
R2332:Dnaja2 UTSW 8 85540136 missense probably damaging 1.00
R3105:Dnaja2 UTSW 8 85555228 missense probably damaging 1.00
R3693:Dnaja2 UTSW 8 85546620 missense probably damaging 0.99
R4803:Dnaja2 UTSW 8 85553400 missense probably damaging 1.00
R5109:Dnaja2 UTSW 8 85553258 missense possibly damaging 0.51
R5428:Dnaja2 UTSW 8 85540175 missense probably benign
R5576:Dnaja2 UTSW 8 85539404 missense possibly damaging 0.95
R7055:Dnaja2 UTSW 8 85548674 missense probably benign 0.00
R7385:Dnaja2 UTSW 8 85539353 missense probably benign
R7662:Dnaja2 UTSW 8 85539276 missense probably benign 0.17
R7693:Dnaja2 UTSW 8 85540310 missense probably damaging 1.00
R8049:Dnaja2 UTSW 8 85539247 missense possibly damaging 0.63
Z1177:Dnaja2 UTSW 8 85540071 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCATTCCTTCACCTCGAAC -3'
(R):5'- GCTTTGAAATTAGGGACAGTGGC -3'

Sequencing Primer
(F):5'- TTCCTTCACCTCGAACAACACG -3'
(R):5'- AAATTAGGGACAGTGGCTTTTTGGC -3'
Posted On2015-03-25