Incidental Mutation 'R3787:Inpp5k'
ID272329
Institutional Source Beutler Lab
Gene Symbol Inpp5k
Ensembl Gene ENSMUSG00000006127
Gene Nameinositol polyphosphate 5-phosphatase K
Synonymsputative PI-5-phosphatase, PI-5-phosphatase related, C62, Pps
MMRRC Submission 040754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3787 (G1)
Quality Score181
Status Not validated
Chromosome11
Chromosomal Location75630988-75648871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75647686 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 461 (L461P)
Ref Sequence ENSEMBL: ENSMUSP00000006286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006286] [ENSMUST00000069057] [ENSMUST00000102504] [ENSMUST00000102505] [ENSMUST00000139856] [ENSMUST00000150857]
Predicted Effect probably damaging
Transcript: ENSMUST00000006286
AA Change: L461P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006286
Gene: ENSMUSG00000006127
AA Change: L461P

DomainStartEndE-ValueType
IPPc 30 345 1.03e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069057
SMART Domains Protein: ENSMUSP00000070388
Gene: ENSMUSG00000017774

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102504
SMART Domains Protein: ENSMUSP00000099562
Gene: ENSMUSG00000017774

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102505
SMART Domains Protein: ENSMUSP00000099563
Gene: ENSMUSG00000017774

DomainStartEndE-ValueType
MYSc 40 732 N/A SMART
IQ 733 755 3.85e-3 SMART
IQ 756 778 2.09e-4 SMART
Blast:MYSc 786 815 6e-9 BLAST
low complexity region 839 850 N/A INTRINSIC
Pfam:Myosin_TH1 874 1052 2.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136605
Predicted Effect probably damaging
Transcript: ENSMUST00000139856
AA Change: L105P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121060
Gene: ENSMUSG00000006127
AA Change: L105P

DomainStartEndE-ValueType
Blast:IPPc 18 94 4e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149134
Predicted Effect probably benign
Transcript: ENSMUST00000150857
Meta Mutation Damage Score 0.1822 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 5-phosphatase activity toward polyphosphate inositol. The protein localizes to the cytosol in regions lacking actin stress fibers. It is thought that this protein may negatively regulate the actin cytoskeleton. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic lethality. Adult heterozygous mutant mice show normal food intake and adiposity but exhibit enhanced glucose homeostasis and insulin sensitivity, increased insulin action in skeletal muscle, and reduced diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Aprt T C 8: 122,575,529 D65G probably benign Het
Auh C A 13: 52,929,457 R62L possibly damaging Het
Bmp4 C T 14: 46,385,714 probably null Het
Bptf C A 11: 107,073,827 D1514Y probably damaging Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc112 C T 18: 46,299,298 R72H probably benign Het
Ccdc138 T C 10: 58,538,270 Y371H probably damaging Het
Chsy3 T C 18: 59,408,998 Y403H probably damaging Het
Cul4a T C 8: 13,133,668 V352A probably damaging Het
D5Ertd577e T A 5: 95,482,897 L211Q probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Dmxl2 T C 9: 54,369,878 D2893G probably damaging Het
Dnah8 A G 17: 30,755,041 D2800G probably damaging Het
Dnaja2 C T 8: 85,540,386 G281R probably damaging Het
Exo1 A G 1: 175,899,469 T449A probably benign Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Fmo1 A T 1: 162,830,014 S519R possibly damaging Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Mcm9 A G 10: 53,615,980 V415A possibly damaging Het
Mki67 A T 7: 135,700,283 N1007K possibly damaging Het
Mpped1 A T 15: 83,796,583 probably benign Het
Mtpap T C 18: 4,380,670 V116A probably damaging Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nfs1 A G 2: 156,128,583 I270T possibly damaging Het
Nr1i3 A G 1: 171,214,425 D26G probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfr61 G A 7: 140,637,835 V45I probably benign Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pde4dip G T 3: 97,715,552 P1447Q possibly damaging Het
Plxna2 A G 1: 194,643,934 T59A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r12c G A 7: 4,486,584 A193V probably damaging Het
Prdm15 G T 16: 97,797,745 H904Q probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Reep1 T A 6: 71,795,215 D162E probably damaging Het
Rev3l T A 10: 39,846,210 L2528Q probably damaging Het
Rfc1 A T 5: 65,296,014 S264T probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Sipa1l2 C T 8: 125,423,205 A1602T probably benign Het
Sipa1l2 C A 8: 125,450,383 C1164F possibly damaging Het
Slc4a1ap T A 5: 31,528,139 L254I possibly damaging Het
Slc5a3 A G 16: 92,077,928 N291S possibly damaging Het
Stab2 T A 10: 86,969,277 D279V possibly damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Vmn1r63 T A 7: 5,802,752 M294L probably benign Het
Vmn2r58 C T 7: 41,864,074 D382N probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Other mutations in Inpp5k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Inpp5k APN 11 75646820 missense possibly damaging 0.72
IGL00470:Inpp5k APN 11 75645525 missense probably benign 0.00
IGL00529:Inpp5k APN 11 75631204 unclassified probably benign
IGL01761:Inpp5k APN 11 75647677 missense possibly damaging 0.75
IGL02532:Inpp5k APN 11 75633184 unclassified probably benign
R0081:Inpp5k UTSW 11 75631147 frame shift probably null
R0206:Inpp5k UTSW 11 75631143 missense probably benign
R0206:Inpp5k UTSW 11 75631143 missense probably benign
R0520:Inpp5k UTSW 11 75639530 nonsense probably null
R0841:Inpp5k UTSW 11 75633459 unclassified probably benign
R1145:Inpp5k UTSW 11 75633459 unclassified probably benign
R1433:Inpp5k UTSW 11 75637491 missense probably benign 0.00
R1605:Inpp5k UTSW 11 75633481 missense probably benign 0.00
R2144:Inpp5k UTSW 11 75647191 critical splice acceptor site probably null
R2145:Inpp5k UTSW 11 75647191 critical splice acceptor site probably null
R2296:Inpp5k UTSW 11 75639487 missense probably damaging 1.00
R3783:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R3784:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R3785:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R5999:Inpp5k UTSW 11 75633100 missense probably damaging 0.99
R6337:Inpp5k UTSW 11 75646814 missense probably damaging 1.00
R6405:Inpp5k UTSW 11 75633178 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTTCAAGGTAAGGGGTTGC -3'
(R):5'- TTAAAGGGCCAGTTCCTCTG -3'

Sequencing Primer
(F):5'- CTTCAAGGTAAGGGGTTGCTGTTG -3'
(R):5'- AGGAGTCTAGCTGAGCTCCTCTG -3'
Posted On2015-03-25