Mutagenetix > Incidental Mutation

Incidental Mutation 'R3787:Thbs4'

272336

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

040754-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3787 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92773164 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 375 (N375S)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

probably benign
Transcript: ENSMUST00000022213
AA Change: N375S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: N375S

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168299

Meta Mutation Damage Score

0.0654

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082I17Rik	G	T	5: 139,455,442	P35Q	probably damaging	Het
Aoc1	T	C	6: 48,905,655	L177P	probably damaging	Het
Aprt	T	C	8: 122,575,529	D65G	probably benign	Het
Auh	C	A	13: 52,929,457	R62L	possibly damaging	Het
Bmp4	C	T	14: 46,385,714		probably null	Het
Bptf	C	A	11: 107,073,827	D1514Y	probably damaging	Het
Carmil3	T	C	14: 55,496,976	F418S	probably damaging	Het
Ccdc112	C	T	18: 46,299,298	R72H	probably benign	Het
Ccdc138	T	C	10: 58,538,270	Y371H	probably damaging	Het
Chsy3	T	C	18: 59,408,998	Y403H	probably damaging	Het
Cul4a	T	C	8: 13,133,668	V352A	probably damaging	Het
D5Ertd577e	T	A	5: 95,482,897	L211Q	probably damaging	Het
Dennd3	T	C	15: 73,547,577	V739A	possibly damaging	Het
Dmxl1	G	A	18: 49,865,122	S763N	probably damaging	Het
Dmxl2	T	C	9: 54,369,878	D2893G	probably damaging	Het
Dnah8	A	G	17: 30,755,041	D2800G	probably damaging	Het
Dnaja2	C	T	8: 85,540,386	G281R	probably damaging	Het
Exo1	A	G	1: 175,899,469	T449A	probably benign	Het
Fancd2	T	G	6: 113,565,204	S770A	probably damaging	Het
Fmo1	A	T	1: 162,830,014	S519R	possibly damaging	Het
Fryl	T	C	5: 73,101,476	Y655C	probably benign	Het
Gpt2	G	T	8: 85,525,573	V506L	probably benign	Het
Heatr1	G	T	13: 12,434,460	L1946F	probably damaging	Het
Inpp5k	T	C	11: 75,647,686	L461P	probably damaging	Het
Magi2	C	T	5: 20,465,909	T580M	probably damaging	Het
Mcm9	A	G	10: 53,615,980	V415A	possibly damaging	Het
Mki67	A	T	7: 135,700,283	N1007K	possibly damaging	Het
Mpped1	A	T	15: 83,796,583		probably benign	Het
Mtpap	T	C	18: 4,380,670	V116A	probably damaging	Het
Myo15	A	T	11: 60,477,572	Y386F	probably damaging	Het
Neurod1	T	A	2: 79,454,595	N148I	probably damaging	Het
Nfs1	A	G	2: 156,128,583	I270T	possibly damaging	Het
Nr1i3	A	G	1: 171,214,425	D26G	probably damaging	Het
Nsa2	G	T	13: 97,135,534	Q60K	possibly damaging	Het
Olfr61	G	A	7: 140,637,835	V45I	probably benign	Het
Olfr951	T	C	9: 39,394,382	V197A	probably benign	Het
Pde4dip	G	T	3: 97,715,552	P1447Q	possibly damaging	Het
Plxna2	A	G	1: 194,643,934	T59A	probably benign	Het
Pmepa1	G	A	2: 173,228,133	R210W	probably damaging	Het
Ppp1r12c	G	A	7: 4,486,584	A193V	probably damaging	Het
Prdm15	G	T	16: 97,797,745	H904Q	probably benign	Het
Rala	T	A	13: 17,882,446	E185V	probably benign	Het
Reep1	T	A	6: 71,795,215	D162E	probably damaging	Het
Rev3l	T	A	10: 39,846,210	L2528Q	probably damaging	Het
Rfc1	A	T	5: 65,296,014	S264T	probably benign	Het
Sall4	A	G	2: 168,756,123	S266P	probably damaging	Het
Sipa1l2	C	T	8: 125,423,205	A1602T	probably benign	Het
Sipa1l2	C	A	8: 125,450,383	C1164F	possibly damaging	Het
Slc4a1ap	T	A	5: 31,528,139	L254I	possibly damaging	Het
Slc5a3	A	G	16: 92,077,928	N291S	possibly damaging	Het
Stab2	T	A	10: 86,969,277	D279V	possibly damaging	Het
Synrg	T	C	11: 84,001,920	F613S	probably damaging	Het
Tekt1	A	G	11: 72,344,894	I376T	probably damaging	Het
Tro	G	A	X: 150,655,052	T203I	possibly damaging	Het
Txnl4b	C	T	8: 109,572,777	A123V	probably damaging	Het
Vmn1r63	T	A	7: 5,802,752	M294L	probably benign	Het
Vmn2r58	C	T	7: 41,864,074	D382N	probably benign	Het
Wap	G	A	11: 6,638,550	Q25*	probably null	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTGCCTTCCCAGAGATACC -3'
(R):5'- GAACGTTCCAAGTTATTTCCCC -3'

Sequencing Primer
(F):5'- GGCATATGTCTTCAGAAAGGAGCC -3'
(R):5'- GTTCCAAGTTATTTCCCCCAAAGAG -3'

Posted On

2015-03-25