Incidental Mutation 'R3787:Nsa2'
ID272337
Institutional Source Beutler Lab
Gene Symbol Nsa2
Ensembl Gene ENSMUSG00000060739
Gene NameNSA2 ribosome biogenesis homolog
Synonyms5730427N09Rik, LNR42, Nsa2p, Yr29
MMRRC Submission 040754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3787 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location97129424-97137937 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97135534 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 60 (Q60K)
Ref Sequence ENSEMBL: ENSMUSP00000073161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022170] [ENSMUST00000042084] [ENSMUST00000073456] [ENSMUST00000160139] [ENSMUST00000161639] [ENSMUST00000161825] [ENSMUST00000161913] [ENSMUST00000161929] [ENSMUST00000169863] [ENSMUST00000225410]
Predicted Effect probably benign
Transcript: ENSMUST00000022170
SMART Domains Protein: ENSMUSP00000022170
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 66 349 9.9e-64 PFAM
Pfam:GTP_EFTU_D2 379 446 4.3e-8 PFAM
low complexity region 447 473 N/A INTRINSIC
Pfam:EFG_II 482 556 3.9e-29 PFAM
EFG_IV 558 677 2.94e-17 SMART
EFG_C 679 766 1.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042084
SMART Domains Protein: ENSMUSP00000048373
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 324 4.6e-64 PFAM
Pfam:GTP_EFTU_D2 354 421 4.2e-8 PFAM
low complexity region 422 448 N/A INTRINSIC
Pfam:EFG_II 457 531 3.7e-29 PFAM
EFG_IV 533 652 2.94e-17 SMART
EFG_C 654 741 1.9e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073456
AA Change: Q60K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073161
Gene: ENSMUSG00000060739
AA Change: Q60K

DomainStartEndE-ValueType
Pfam:Ribosomal_S8e 1 259 1.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160139
SMART Domains Protein: ENSMUSP00000124426
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 241 3.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161518
Predicted Effect probably benign
Transcript: ENSMUST00000161639
SMART Domains Protein: ENSMUSP00000125656
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 1.2e-68 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 4.5e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 768 1.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161825
SMART Domains Protein: ENSMUSP00000125088
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 2.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 1.1e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 7.1e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 738 3.46e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161843
Predicted Effect probably benign
Transcript: ENSMUST00000161913
SMART Domains Protein: ENSMUSP00000124253
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 3.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 3.2e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 532 2.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161929
SMART Domains Protein: ENSMUSP00000125306
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 94 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169863
SMART Domains Protein: ENSMUSP00000126209
Gene: ENSMUSG00000041817

DomainStartEndE-ValueType
low complexity region 374 386 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224980
Predicted Effect possibly damaging
Transcript: ENSMUST00000225410
AA Change: Q60K

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.0919 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein involved in cell cycle regulation and proliferation. This gene was identified based on sequence similarity to a highly conserved Saccharomyces cerevisiae gene encoding a pre-ribosomal protein, which is involved in large ribosomal subunit biogenesis. The encoded protein is found at elevated levels in diabetic nephropathy. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Aprt T C 8: 122,575,529 D65G probably benign Het
Auh C A 13: 52,929,457 R62L possibly damaging Het
Bmp4 C T 14: 46,385,714 probably null Het
Bptf C A 11: 107,073,827 D1514Y probably damaging Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc112 C T 18: 46,299,298 R72H probably benign Het
Ccdc138 T C 10: 58,538,270 Y371H probably damaging Het
Chsy3 T C 18: 59,408,998 Y403H probably damaging Het
Cul4a T C 8: 13,133,668 V352A probably damaging Het
D5Ertd577e T A 5: 95,482,897 L211Q probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Dmxl2 T C 9: 54,369,878 D2893G probably damaging Het
Dnah8 A G 17: 30,755,041 D2800G probably damaging Het
Dnaja2 C T 8: 85,540,386 G281R probably damaging Het
Exo1 A G 1: 175,899,469 T449A probably benign Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Fmo1 A T 1: 162,830,014 S519R possibly damaging Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Mcm9 A G 10: 53,615,980 V415A possibly damaging Het
Mki67 A T 7: 135,700,283 N1007K possibly damaging Het
Mpped1 A T 15: 83,796,583 probably benign Het
Mtpap T C 18: 4,380,670 V116A probably damaging Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nfs1 A G 2: 156,128,583 I270T possibly damaging Het
Nr1i3 A G 1: 171,214,425 D26G probably damaging Het
Olfr61 G A 7: 140,637,835 V45I probably benign Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pde4dip G T 3: 97,715,552 P1447Q possibly damaging Het
Plxna2 A G 1: 194,643,934 T59A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r12c G A 7: 4,486,584 A193V probably damaging Het
Prdm15 G T 16: 97,797,745 H904Q probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Reep1 T A 6: 71,795,215 D162E probably damaging Het
Rev3l T A 10: 39,846,210 L2528Q probably damaging Het
Rfc1 A T 5: 65,296,014 S264T probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Sipa1l2 C A 8: 125,450,383 C1164F possibly damaging Het
Sipa1l2 C T 8: 125,423,205 A1602T probably benign Het
Slc4a1ap T A 5: 31,528,139 L254I possibly damaging Het
Slc5a3 A G 16: 92,077,928 N291S possibly damaging Het
Stab2 T A 10: 86,969,277 D279V possibly damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Vmn1r63 T A 7: 5,802,752 M294L probably benign Het
Vmn2r58 C T 7: 41,864,074 D382N probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Other mutations in Nsa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Nsa2 APN 13 97132017 missense probably damaging 1.00
R3783:Nsa2 UTSW 13 97135534 missense possibly damaging 0.93
R3784:Nsa2 UTSW 13 97135534 missense possibly damaging 0.93
R3786:Nsa2 UTSW 13 97135534 missense possibly damaging 0.93
R3878:Nsa2 UTSW 13 97132034 missense probably benign 0.05
R7466:Nsa2 UTSW 13 97131220 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCCAGCAGATAGGCAGGGAC -3'
(R):5'- GTAAGCACATGAATACTGTCCAAG -3'

Sequencing Primer
(F):5'- GGTTCAGAATGTGCACAG -3'
(R):5'- CGACCACCTGTAATGAGATCTGATG -3'
Posted On2015-03-25