Incidental Mutation 'R3787:Tro'
ID272351
Institutional Source Beutler Lab
Gene Symbol Tro
Ensembl Gene ENSMUSG00000025272
Gene Nametrophinin
SynonymsMaged3, Maged3l, magphinin, magphinin-alpha, magphinin-beta 2, magphinin-gamma, necdin and trophinin like, Tnn, Trol, trophinin-2
MMRRC Submission 040754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R3787 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location150645304-150657583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 150655052 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 203 (T203I)
Ref Sequence ENSEMBL: ENSMUSP00000116905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087253] [ENSMUST00000087258] [ENSMUST00000112709] [ENSMUST00000148604] [ENSMUST00000151403] [ENSMUST00000163450] [ENSMUST00000163969] [ENSMUST00000164071]
Predicted Effect probably benign
Transcript: ENSMUST00000087253
AA Change: T203I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000084508
Gene: ENSMUSG00000025272
AA Change: T203I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_2 62 105 5.33e-6 PROSPERO
internal_repeat_1 95 280 8.68e-15 PROSPERO
internal_repeat_2 120 164 5.33e-6 PROSPERO
internal_repeat_1 275 441 8.68e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 8e-60 PFAM
SCOP:d1gt91_ 780 951 9e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000087258
AA Change: T203I
SMART Domains Protein: ENSMUSP00000084513
Gene: ENSMUSG00000025272
AA Change: T203I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_3 62 105 6.04e-6 PROSPERO
internal_repeat_2 95 280 2.73e-15 PROSPERO
internal_repeat_3 120 164 6.04e-6 PROSPERO
internal_repeat_2 275 441 2.73e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 1.6e-58 PFAM
low complexity region 794 810 N/A INTRINSIC
low complexity region 891 1028 N/A INTRINSIC
low complexity region 1057 1073 N/A INTRINSIC
low complexity region 1087 1108 N/A INTRINSIC
low complexity region 1110 1142 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
low complexity region 1157 1175 N/A INTRINSIC
internal_repeat_1 1176 1361 9.97e-23 PROSPERO
low complexity region 1393 1409 N/A INTRINSIC
internal_repeat_1 1540 1728 9.97e-23 PROSPERO
low complexity region 1764 1786 N/A INTRINSIC
low complexity region 1790 1815 N/A INTRINSIC
low complexity region 1821 1836 N/A INTRINSIC
low complexity region 1870 1910 N/A INTRINSIC
low complexity region 1915 1931 N/A INTRINSIC
low complexity region 1962 2085 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112709
AA Change: T203I
SMART Domains Protein: ENSMUSP00000108329
Gene: ENSMUSG00000025272
AA Change: T203I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_3 62 105 6.04e-6 PROSPERO
internal_repeat_2 95 280 2.73e-15 PROSPERO
internal_repeat_3 120 164 6.04e-6 PROSPERO
internal_repeat_2 275 441 2.73e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
MAGE 596 765 2.03e-90 SMART
low complexity region 794 810 N/A INTRINSIC
low complexity region 891 1028 N/A INTRINSIC
low complexity region 1057 1073 N/A INTRINSIC
low complexity region 1087 1108 N/A INTRINSIC
low complexity region 1110 1142 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
low complexity region 1157 1175 N/A INTRINSIC
internal_repeat_1 1176 1361 9.97e-23 PROSPERO
low complexity region 1393 1409 N/A INTRINSIC
internal_repeat_1 1540 1728 9.97e-23 PROSPERO
low complexity region 1764 1786 N/A INTRINSIC
low complexity region 1790 1815 N/A INTRINSIC
low complexity region 1821 1836 N/A INTRINSIC
low complexity region 1870 1910 N/A INTRINSIC
low complexity region 1915 1931 N/A INTRINSIC
low complexity region 1962 2085 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000148604
AA Change: T203I

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116905
Gene: ENSMUSG00000025272
AA Change: T203I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_1 95 280 5.1e-9 PROSPERO
internal_repeat_1 275 441 5.1e-9 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000151403
AA Change: T203I
SMART Domains Protein: ENSMUSP00000120457
Gene: ENSMUSG00000025272
AA Change: T203I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_1 95 280 6.85e-11 PROSPERO
internal_repeat_1 275 441 6.85e-11 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 6.3e-60 PFAM
low complexity region 794 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163450
Predicted Effect unknown
Transcript: ENSMUST00000163969
AA Change: T203I
SMART Domains Protein: ENSMUSP00000126054
Gene: ENSMUSG00000025272
AA Change: T203I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_1 95 280 5.6e-10 PROSPERO
internal_repeat_1 275 441 5.6e-10 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 5.9e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164071
SMART Domains Protein: ENSMUSP00000126042
Gene: ENSMUSG00000025272

DomainStartEndE-ValueType
Pfam:MAGE 54 223 7.1e-61 PFAM
low complexity region 252 266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165192
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171775
Meta Mutation Damage Score 0.1267 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein that mediates cell adhesion between trophoblastic cells and the epithelial cells of the endometrium. The encoded protein participates in cell signalling during embryo implantation, and may also be involved in cancer formation. This gene is located near several other closely related genes on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
PHENOTYPE: Homozygous female or hemizygous male mice on a mixed 129 and NIH black Swiss background are viable, fertile and elderly mice exhibit no disorders. On an inbred 129 background, homozygous female or hemizygous male mice show partial embryonic lethality between E3.5 and E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Aprt T C 8: 122,575,529 D65G probably benign Het
Auh C A 13: 52,929,457 R62L possibly damaging Het
Bmp4 C T 14: 46,385,714 probably null Het
Bptf C A 11: 107,073,827 D1514Y probably damaging Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc112 C T 18: 46,299,298 R72H probably benign Het
Ccdc138 T C 10: 58,538,270 Y371H probably damaging Het
Chsy3 T C 18: 59,408,998 Y403H probably damaging Het
Cul4a T C 8: 13,133,668 V352A probably damaging Het
D5Ertd577e T A 5: 95,482,897 L211Q probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Dmxl2 T C 9: 54,369,878 D2893G probably damaging Het
Dnah8 A G 17: 30,755,041 D2800G probably damaging Het
Dnaja2 C T 8: 85,540,386 G281R probably damaging Het
Exo1 A G 1: 175,899,469 T449A probably benign Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Fmo1 A T 1: 162,830,014 S519R possibly damaging Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Mcm9 A G 10: 53,615,980 V415A possibly damaging Het
Mki67 A T 7: 135,700,283 N1007K possibly damaging Het
Mpped1 A T 15: 83,796,583 probably benign Het
Mtpap T C 18: 4,380,670 V116A probably damaging Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nfs1 A G 2: 156,128,583 I270T possibly damaging Het
Nr1i3 A G 1: 171,214,425 D26G probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfr61 G A 7: 140,637,835 V45I probably benign Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pde4dip G T 3: 97,715,552 P1447Q possibly damaging Het
Plxna2 A G 1: 194,643,934 T59A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r12c G A 7: 4,486,584 A193V probably damaging Het
Prdm15 G T 16: 97,797,745 H904Q probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Reep1 T A 6: 71,795,215 D162E probably damaging Het
Rev3l T A 10: 39,846,210 L2528Q probably damaging Het
Rfc1 A T 5: 65,296,014 S264T probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Sipa1l2 C T 8: 125,423,205 A1602T probably benign Het
Sipa1l2 C A 8: 125,450,383 C1164F possibly damaging Het
Slc4a1ap T A 5: 31,528,139 L254I possibly damaging Het
Slc5a3 A G 16: 92,077,928 N291S possibly damaging Het
Stab2 T A 10: 86,969,277 D279V possibly damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Vmn1r63 T A 7: 5,802,752 M294L probably benign Het
Vmn2r58 C T 7: 41,864,074 D382N probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Other mutations in Tro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Tro APN X 150655325 missense probably benign 0.45
IGL00818:Tro APN X 150648361 missense probably damaging 1.00
IGL03170:Tro APN X 150655560 missense probably benign 0.36
R0022:Tro UTSW X 150647512 intron probably benign
R0049:Tro UTSW X 150654569 missense possibly damaging 0.56
R1378:Tro UTSW X 150655571 missense probably damaging 1.00
R2228:Tro UTSW X 150655481 missense probably benign 0.17
R3080:Tro UTSW X 150655202 missense probably benign 0.09
R3437:Tro UTSW X 150646256 intron probably benign
R3715:Tro UTSW X 150654234 missense probably damaging 1.00
R3783:Tro UTSW X 150655052 missense possibly damaging 0.83
R3840:Tro UTSW X 150646202 intron probably benign
R4001:Tro UTSW X 150655202 missense probably benign 0.09
R5449:Tro UTSW X 150645970 intron probably benign
R7112:Tro UTSW X 150645856 intron probably benign
R7519:Tro UTSW X 150654520 intron probably benign
R7903:Tro UTSW X 150654520 intron probably benign
R7909:Tro UTSW X 150648624 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGTCTGCTAGATGCCTCAATG -3'
(R):5'- GGTATCCCTAACTGGCAGTGAG -3'

Sequencing Primer
(F):5'- AATGGCATTTGAGGCCTC -3'
(R):5'- TGAGGATGCCACTACACAGCTG -3'
Posted On2015-03-25