Mutagenetix > Incidental Mutation

Incidental Mutation 'R3788:Mgat5'

272353

Institutional Source

Beutler Lab

Gene Symbol

Mgat5

Ensembl Gene

ENSMUSG00000036155

Gene Name

mannoside acetylglucosaminyltransferase 5

Synonyms

4930471A21Rik, beta1,6N-acetylglucosaminyltransferase V, GlcNAc-TV, 5330407H02Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3788 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127205015-127488336 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 127366443 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 174 (D174G)

Ref Sequence

ENSEMBL: ENSMUSP00000129166 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038361] [ENSMUST00000171405]

AlphaFold

Q8R4G6

Predicted Effect

probably benign
Transcript: ENSMUST00000038361
AA Change: D174G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000038359
Gene: ENSMUSG00000036155
AA Change: D174G

Domain	Start	End	E-Value	Type
Pfam:DUF4525	2	138	3.4e-70	PFAM
Pfam:Glyco_transf_18	171	725	9.8e-268	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171405
AA Change: D174G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155
AA Change: D174G

Domain	Start	End	E-Value	Type
Pfam:DUF4525	3	137	9.3e-64	PFAM
Pfam:Glyco_transf_18	171	725	1.9e-268	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189427

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190921

Meta Mutation Damage Score

0.0596

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for deficiencies in this gene have immune system abnormalities and reduced cancer growth and metastasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,288,297		probably null	Het
Abca4	T	A	3: 122,052,912	V26E	possibly damaging	Het
Abhd16a	A	G	17: 35,101,587	N411S	probably damaging	Het
Akap13	G	A	7: 75,702,153		probably null	Het
Aph1b	T	C	9: 66,794,066		probably benign	Het
Aspm	C	T	1: 139,463,203	T742I	probably damaging	Het
Bclaf3	A	G	X: 159,566,496	H619R	probably benign	Het
Cemip	A	T	7: 83,943,898	L1199H	probably damaging	Het
Chd2	G	A	7: 73,447,130		probably benign	Het
Clnk	A	G	5: 38,714,998	Y310H	probably damaging	Het
Crmp1	A	G	5: 37,284,140	D522G	probably damaging	Het
Cyth3	A	G	5: 143,636,543		probably benign	Het
Dcbld1	T	A	10: 52,319,658	Y392N	probably damaging	Het
Fam60a	A	G	6: 148,926,119	S134P	possibly damaging	Het
Flnc	T	C	6: 29,454,057	F1820L	probably damaging	Het
Galnt18	G	A	7: 111,520,115	R385*	probably null	Het
Gpatch3	C	A	4: 133,575,168	R137S	possibly damaging	Het
Gpc6	C	T	14: 117,624,466	P265S	probably damaging	Het
Harbi1	T	A	2: 91,720,607	D308E	probably benign	Het
Hdhd2	G	A	18: 76,955,187		probably null	Het
Hk1	T	C	10: 62,275,688	K737E	possibly damaging	Het
Hnrnpr	G	A	4: 136,336,313	V345M	probably damaging	Het
Kalrn	T	C	16: 34,220,240	H944R	probably damaging	Het
Kdm2a	A	T	19: 4,351,805	C207S	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt75	C	T	15: 101,573,521	G104D	possibly damaging	Het
Lnpk	A	T	2: 74,522,263	S358R	probably benign	Het
Map2	A	G	1: 66,416,863	T1512A	probably damaging	Het
March10	T	A	11: 105,397,079	L132F	probably damaging	Het
Mfrp	G	A	9: 44,105,457	W65*	probably null	Het
Miga2	T	A	2: 30,371,225	Y177*	probably null	Het
Mroh3	T	C	1: 136,185,475	D747G	probably damaging	Het
Muc5b	A	G	7: 141,863,834	T3506A	possibly damaging	Het
Myo7b	G	T	18: 31,974,112	P1277T	possibly damaging	Het
Naaa	C	T	5: 92,272,554		probably null	Het
Ndufs2	T	C	1: 171,235,320	D410G	possibly damaging	Het
Olfr506	T	A	7: 108,613,073	Y255*	probably null	Het
Olfr559	A	G	7: 102,723,487		probably null	Het
Olfr873	A	G	9: 20,300,370	I58V	probably benign	Het
Olfr955	A	G	9: 39,470,069	I219T	probably benign	Het
Osbp	A	T	19: 11,978,921	Y409F	probably benign	Het
Plxnb1	T	A	9: 109,109,287	V1303D	possibly damaging	Het
Prkcg	G	A	7: 3,313,747	D246N	probably damaging	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,219,203		probably benign	Het
Sbf1	G	A	15: 89,299,528	R1261*	probably null	Het
Scn4a	T	C	11: 106,344,274	N341S	probably damaging	Het
Sec61a2	C	A	2: 5,879,625		probably null	Het
Sgcd	T	A	11: 47,355,205	K57*	probably null	Het
Slc12a5	T	C	2: 164,993,775	L861P	probably damaging	Het
Slc6a16	A	G	7: 45,259,962	D184G	probably benign	Het
Snx7	A	G	3: 117,838,990		probably benign	Het
Sptbn2	A	G	19: 4,745,922	I1710V	probably damaging	Het
Sytl2	A	T	7: 90,376,081	I426F	probably benign	Het
Tdp1	A	G	12: 99,891,752		probably benign	Het
Tmem232	C	A	17: 65,382,633	D496Y	possibly damaging	Het
Tomm20l	C	T	12: 71,111,742	A58V	possibly damaging	Het
Ttc26	T	A	6: 38,403,524		probably null	Het
Ttn	T	C	2: 76,945,274	E1854G	unknown	Het
Ttn	A	G	2: 76,974,208	V240A	probably benign	Het
Vmn2r98	A	T	17: 19,080,625	T630S	probably benign	Het
Xrcc1	G	C	7: 24,566,908	A220P	probably benign	Het

Other mutations in Mgat5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Mgat5	APN	1	127387467	missense	probably damaging	1.00
IGL00813:Mgat5	APN	1	127384806	missense	probably benign
IGL01795:Mgat5	APN	1	127469231	missense	probably damaging	0.98
IGL01830:Mgat5	APN	1	127412132	missense	probably damaging	1.00
IGL01879:Mgat5	APN	1	127397550	missense	probably damaging	0.99
IGL02322:Mgat5	APN	1	127382985	missense	probably benign	0.00
IGL02621:Mgat5	APN	1	127397589	missense	possibly damaging	0.86
IGL02695:Mgat5	APN	1	127412131	missense	probably damaging	1.00
IGL03142:Mgat5	APN	1	127412223	missense	probably damaging	1.00
Cowlick	UTSW	1	127471564	missense	probably benign	0.36
Curls	UTSW	1	127320634	missense	possibly damaging	0.77
R0518:Mgat5	UTSW	1	127384847	missense	probably damaging	1.00
R0594:Mgat5	UTSW	1	127412248	missense	probably damaging	0.96
R1480:Mgat5	UTSW	1	127459979	missense	probably damaging	1.00
R1501:Mgat5	UTSW	1	127397641	critical splice donor site	probably null
R1712:Mgat5	UTSW	1	127320638	missense	probably benign	0.34
R1744:Mgat5	UTSW	1	127479469	missense	probably damaging	1.00
R1862:Mgat5	UTSW	1	127459969	missense	probably damaging	1.00
R1994:Mgat5	UTSW	1	127459959	missense	possibly damaging	0.82
R2054:Mgat5	UTSW	1	127397607	missense	probably damaging	1.00
R2150:Mgat5	UTSW	1	127469250	missense	probably damaging	1.00
R2303:Mgat5	UTSW	1	127446299	missense	probably benign	0.00
R2566:Mgat5	UTSW	1	127307004	missense	probably benign	0.01
R3498:Mgat5	UTSW	1	127384834	missense	possibly damaging	0.55
R4674:Mgat5	UTSW	1	127390758	missense	probably damaging	1.00
R4873:Mgat5	UTSW	1	127469249	missense	probably damaging	1.00
R4875:Mgat5	UTSW	1	127469249	missense	probably damaging	1.00
R5175:Mgat5	UTSW	1	127459912	missense	probably damaging	0.97
R5310:Mgat5	UTSW	1	127387514	critical splice donor site	probably null
R5337:Mgat5	UTSW	1	127459921	missense	possibly damaging	0.84
R5597:Mgat5	UTSW	1	127397566	missense	probably damaging	1.00
R5599:Mgat5	UTSW	1	127397566	missense	probably damaging	1.00
R5861:Mgat5	UTSW	1	127387392	missense	probably damaging	1.00
R5956:Mgat5	UTSW	1	127382939	missense	probably benign	0.10
R6042:Mgat5	UTSW	1	127459899	missense	probably damaging	1.00
R6223:Mgat5	UTSW	1	127382979	missense	possibly damaging	0.86
R6492:Mgat5	UTSW	1	127471564	missense	probably benign	0.36
R6662:Mgat5	UTSW	1	127469237	missense	probably damaging	1.00
R6960:Mgat5	UTSW	1	127320634	missense	possibly damaging	0.77
R6981:Mgat5	UTSW	1	127390851	missense	probably damaging	0.98
R7110:Mgat5	UTSW	1	127382979	missense	possibly damaging	0.92
R7133:Mgat5	UTSW	1	127365189	missense	probably benign
R7142:Mgat5	UTSW	1	127412187	missense	probably damaging	1.00
R7151:Mgat5	UTSW	1	127446262	missense	probably damaging	0.97
R7506:Mgat5	UTSW	1	127366455	missense	probably benign	0.24
R7790:Mgat5	UTSW	1	127412204	missense	probably benign	0.23
R7980:Mgat5	UTSW	1	127479511	missense	probably benign	0.13
R8548:Mgat5	UTSW	1	127320672	missense	possibly damaging	0.77
R9008:Mgat5	UTSW	1	127479571	missense	probably damaging	1.00
R9127:Mgat5	UTSW	1	127366460	missense	probably benign	0.14
R9279:Mgat5	UTSW	1	127397611	missense	probably damaging	1.00
R9599:Mgat5	UTSW	1	127320708	missense	probably benign	0.02
X0028:Mgat5	UTSW	1	127366485	missense	possibly damaging	0.91
Z1177:Mgat5	UTSW	1	127482692	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAGCATCTGGAACTCTCCC -3'
(R):5'- CCTTTATGGGACGGTGTCAGAG -3'

Sequencing Primer
(F):5'- GATCTGAGCATCTGGTCACC -3'
(R):5'- TCAGAGCAAAGTGAGATGTCGC -3'

Posted On

2015-03-25