Incidental Mutation 'R3788:Snx7'
ID272364
Institutional Source Beutler Lab
Gene Symbol Snx7
Ensembl Gene ENSMUSG00000028007
Gene Namesorting nexin 7
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R3788 (G1)
Quality Score219
Status Validated
Chromosome3
Chromosomal Location117781647-117868936 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 117838990 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029639] [ENSMUST00000167877] [ENSMUST00000198499]
Predicted Effect probably benign
Transcript: ENSMUST00000029639
SMART Domains Protein: ENSMUSP00000029639
Gene: ENSMUSG00000028007

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
PX 85 205 1.55e-22 SMART
coiled coil region 362 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167877
SMART Domains Protein: ENSMUSP00000125804
Gene: ENSMUSG00000028007

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
PX 57 196 3.62e-2 SMART
coiled coil region 279 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169812
SMART Domains Protein: ENSMUSP00000128007
Gene: ENSMUSG00000028007

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
PX 77 197 1.55e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198499
SMART Domains Protein: ENSMUSP00000143230
Gene: ENSMUSG00000028007

DomainStartEndE-ValueType
PX 27 147 1.55e-22 SMART
coiled coil region 304 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region like some family members, and its exact function is unknown. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,288,297 probably null Het
Abca4 T A 3: 122,052,912 V26E possibly damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Akap13 G A 7: 75,702,153 probably null Het
Aph1b T C 9: 66,794,066 probably benign Het
Aspm C T 1: 139,463,203 T742I probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Cemip A T 7: 83,943,898 L1199H probably damaging Het
Chd2 G A 7: 73,447,130 probably benign Het
Clnk A G 5: 38,714,998 Y310H probably damaging Het
Crmp1 A G 5: 37,284,140 D522G probably damaging Het
Cyth3 A G 5: 143,636,543 probably benign Het
Dcbld1 T A 10: 52,319,658 Y392N probably damaging Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Flnc T C 6: 29,454,057 F1820L probably damaging Het
Galnt18 G A 7: 111,520,115 R385* probably null Het
Gpatch3 C A 4: 133,575,168 R137S possibly damaging Het
Gpc6 C T 14: 117,624,466 P265S probably damaging Het
Harbi1 T A 2: 91,720,607 D308E probably benign Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hk1 T C 10: 62,275,688 K737E possibly damaging Het
Hnrnpr G A 4: 136,336,313 V345M probably damaging Het
Kalrn T C 16: 34,220,240 H944R probably damaging Het
Kdm2a A T 19: 4,351,805 C207S probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt75 C T 15: 101,573,521 G104D possibly damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
March10 T A 11: 105,397,079 L132F probably damaging Het
Mfrp G A 9: 44,105,457 W65* probably null Het
Mgat5 A G 1: 127,366,443 D174G probably benign Het
Miga2 T A 2: 30,371,225 Y177* probably null Het
Mroh3 T C 1: 136,185,475 D747G probably damaging Het
Muc5b A G 7: 141,863,834 T3506A possibly damaging Het
Myo7b G T 18: 31,974,112 P1277T possibly damaging Het
Naaa C T 5: 92,272,554 probably null Het
Ndufs2 T C 1: 171,235,320 D410G possibly damaging Het
Olfr506 T A 7: 108,613,073 Y255* probably null Het
Olfr559 A G 7: 102,723,487 probably null Het
Olfr873 A G 9: 20,300,370 I58V probably benign Het
Olfr955 A G 9: 39,470,069 I219T probably benign Het
Osbp A T 19: 11,978,921 Y409F probably benign Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Prkcg G A 7: 3,313,747 D246N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sbf1 G A 15: 89,299,528 R1261* probably null Het
Scn4a T C 11: 106,344,274 N341S probably damaging Het
Sec61a2 C A 2: 5,879,625 probably null Het
Sgcd T A 11: 47,355,205 K57* probably null Het
Slc12a5 T C 2: 164,993,775 L861P probably damaging Het
Slc6a16 A G 7: 45,259,962 D184G probably benign Het
Sptbn2 A G 19: 4,745,922 I1710V probably damaging Het
Sytl2 A T 7: 90,376,081 I426F probably benign Het
Tdp1 A G 12: 99,891,752 probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttc26 T A 6: 38,403,524 probably null Het
Ttn T C 2: 76,945,274 E1854G unknown Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r98 A T 17: 19,080,625 T630S probably benign Het
Xrcc1 G C 7: 24,566,908 A220P probably benign Het
Other mutations in Snx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02593:Snx7 APN 3 117839960 missense probably damaging 1.00
IGL02859:Snx7 APN 3 117829671 splice site probably benign
IGL03260:Snx7 APN 3 117782293 utr 3 prime probably benign
IGL03357:Snx7 APN 3 117838875 missense probably damaging 1.00
P0026:Snx7 UTSW 3 117840023 missense probably damaging 1.00
R0620:Snx7 UTSW 3 117846675 missense probably damaging 0.96
R0731:Snx7 UTSW 3 117829671 splice site probably benign
R1613:Snx7 UTSW 3 117829573 splice site probably benign
R1621:Snx7 UTSW 3 117837156 missense possibly damaging 0.89
R1911:Snx7 UTSW 3 117829668 splice site probably null
R1912:Snx7 UTSW 3 117829668 splice site probably null
R4663:Snx7 UTSW 3 117800879 missense probably benign 0.00
R5182:Snx7 UTSW 3 117832857 missense probably damaging 1.00
R5681:Snx7 UTSW 3 117846623 missense probably benign 0.10
R6397:Snx7 UTSW 3 117846623 missense probably benign 0.10
R6715:Snx7 UTSW 3 117782336 missense possibly damaging 0.47
R6901:Snx7 UTSW 3 117829636 nonsense probably null
R6996:Snx7 UTSW 3 117846632 missense possibly damaging 0.82
R7049:Snx7 UTSW 3 117840031 missense possibly damaging 0.57
R7372:Snx7 UTSW 3 117782351 missense probably damaging 1.00
R7429:Snx7 UTSW 3 117837212 missense probably benign 0.00
R7741:Snx7 UTSW 3 117838839 missense probably damaging 1.00
R8025:Snx7 UTSW 3 117832877 missense probably benign
R8098:Snx7 UTSW 3 117838934 missense probably benign 0.00
R8125:Snx7 UTSW 3 117837245 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGATACTAAAGGGCCTGCTG -3'
(R):5'- TACAGAGAGCAGCAGGGTTC -3'

Sequencing Primer
(F):5'- AGAACCATTTACCTCGGCCTGTG -3'
(R):5'- CAGGGTTCCTAGGAGCATTTGTATAC -3'
Posted On2015-03-25