Incidental Mutation 'R3788:Snx7'
ID 272364
Institutional Source Beutler Lab
Gene Symbol Snx7
Ensembl Gene ENSMUSG00000028007
Gene Name sorting nexin 7
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R3788 (G1)
Quality Score 219
Status Validated
Chromosome 3
Chromosomal Location 117575296-117662585 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 117632639 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029639] [ENSMUST00000167877] [ENSMUST00000198499]
AlphaFold Q9CY18
Predicted Effect probably benign
Transcript: ENSMUST00000029639
SMART Domains Protein: ENSMUSP00000029639
Gene: ENSMUSG00000028007

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
PX 85 205 1.55e-22 SMART
coiled coil region 362 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167877
SMART Domains Protein: ENSMUSP00000125804
Gene: ENSMUSG00000028007

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
PX 57 196 3.62e-2 SMART
coiled coil region 279 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169812
SMART Domains Protein: ENSMUSP00000128007
Gene: ENSMUSG00000028007

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
PX 77 197 1.55e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198499
SMART Domains Protein: ENSMUSP00000143230
Gene: ENSMUSG00000028007

DomainStartEndE-ValueType
PX 27 147 1.55e-22 SMART
coiled coil region 304 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region like some family members, and its exact function is unknown. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,846,561 (GRCm39) V26E possibly damaging Het
Abhd16a A G 17: 35,320,563 (GRCm39) N411S probably damaging Het
Akap13 G A 7: 75,351,901 (GRCm39) probably null Het
Aph1b T C 9: 66,701,348 (GRCm39) probably benign Het
Aspm C T 1: 139,390,941 (GRCm39) T742I probably damaging Het
Bclaf3 A G X: 158,349,492 (GRCm39) H619R probably benign Het
Bltp2 T A 11: 78,179,123 (GRCm39) probably null Het
Cemip A T 7: 83,593,106 (GRCm39) L1199H probably damaging Het
Chd2 G A 7: 73,096,878 (GRCm39) probably benign Het
Clnk A G 5: 38,872,341 (GRCm39) Y310H probably damaging Het
Crmp1 A G 5: 37,441,484 (GRCm39) D522G probably damaging Het
Cyth3 A G 5: 143,622,298 (GRCm39) probably benign Het
Dcbld1 T A 10: 52,195,754 (GRCm39) Y392N probably damaging Het
Flnc T C 6: 29,454,056 (GRCm39) F1820L probably damaging Het
Galnt18 G A 7: 111,119,322 (GRCm39) R385* probably null Het
Gpatch3 C A 4: 133,302,479 (GRCm39) R137S possibly damaging Het
Gpc6 C T 14: 117,861,878 (GRCm39) P265S probably damaging Het
Harbi1 T A 2: 91,550,952 (GRCm39) D308E probably benign Het
Hdhd2 G A 18: 77,042,883 (GRCm39) probably null Het
Hk1 T C 10: 62,111,467 (GRCm39) K737E possibly damaging Het
Hnrnpr G A 4: 136,063,624 (GRCm39) V345M probably damaging Het
Ift56 T A 6: 38,380,459 (GRCm39) probably null Het
Kalrn T C 16: 34,040,610 (GRCm39) H944R probably damaging Het
Kdm2a A T 19: 4,401,833 (GRCm39) C207S probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt75 C T 15: 101,481,956 (GRCm39) G104D possibly damaging Het
Lnpk A T 2: 74,352,607 (GRCm39) S358R probably benign Het
Map2 A G 1: 66,456,022 (GRCm39) T1512A probably damaging Het
Marchf10 T A 11: 105,287,905 (GRCm39) L132F probably damaging Het
Mfrp G A 9: 44,016,754 (GRCm39) W65* probably null Het
Mgat5 A G 1: 127,294,180 (GRCm39) D174G probably benign Het
Miga2 T A 2: 30,261,237 (GRCm39) Y177* probably null Het
Mroh3 T C 1: 136,113,213 (GRCm39) D747G probably damaging Het
Muc5b A G 7: 141,417,571 (GRCm39) T3506A possibly damaging Het
Myo7b G T 18: 32,107,165 (GRCm39) P1277T possibly damaging Het
Naaa C T 5: 92,420,413 (GRCm39) probably null Het
Ndufs2 T C 1: 171,062,889 (GRCm39) D410G possibly damaging Het
Or51a25 A G 7: 102,372,694 (GRCm39) probably null Het
Or5p78 T A 7: 108,212,280 (GRCm39) Y255* probably null Het
Or7e177 A G 9: 20,211,666 (GRCm39) I58V probably benign Het
Or8g35 A G 9: 39,381,365 (GRCm39) I219T probably benign Het
Osbp A T 19: 11,956,285 (GRCm39) Y409F probably benign Het
Plxnb1 T A 9: 108,938,355 (GRCm39) V1303D possibly damaging Het
Prkcg G A 7: 3,362,263 (GRCm39) D246N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,169,203 (GRCm39) probably benign Het
Sbf1 G A 15: 89,183,731 (GRCm39) R1261* probably null Het
Scn4a T C 11: 106,235,100 (GRCm39) N341S probably damaging Het
Sec61a2 C A 2: 5,884,436 (GRCm39) probably null Het
Sgcd T A 11: 47,246,032 (GRCm39) K57* probably null Het
Sinhcaf A G 6: 148,827,617 (GRCm39) S134P possibly damaging Het
Slc12a5 T C 2: 164,835,695 (GRCm39) L861P probably damaging Het
Slc6a16 A G 7: 44,909,386 (GRCm39) D184G probably benign Het
Sptbn2 A G 19: 4,795,950 (GRCm39) I1710V probably damaging Het
Sytl2 A T 7: 90,025,289 (GRCm39) I426F probably benign Het
Tdp1 A G 12: 99,858,011 (GRCm39) probably benign Het
Tmem232 C A 17: 65,689,628 (GRCm39) D496Y possibly damaging Het
Tomm20l C T 12: 71,158,516 (GRCm39) A58V possibly damaging Het
Ttn T C 2: 76,775,618 (GRCm39) E1854G unknown Het
Ttn A G 2: 76,804,552 (GRCm39) V240A probably benign Het
Vmn2r98 A T 17: 19,300,887 (GRCm39) T630S probably benign Het
Xrcc1 G C 7: 24,266,333 (GRCm39) A220P probably benign Het
Other mutations in Snx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02593:Snx7 APN 3 117,633,609 (GRCm39) missense probably damaging 1.00
IGL02859:Snx7 APN 3 117,623,320 (GRCm39) splice site probably benign
IGL03260:Snx7 APN 3 117,575,942 (GRCm39) utr 3 prime probably benign
IGL03357:Snx7 APN 3 117,632,524 (GRCm39) missense probably damaging 1.00
P0026:Snx7 UTSW 3 117,633,672 (GRCm39) missense probably damaging 1.00
R0620:Snx7 UTSW 3 117,640,324 (GRCm39) missense probably damaging 0.96
R0731:Snx7 UTSW 3 117,623,320 (GRCm39) splice site probably benign
R1613:Snx7 UTSW 3 117,623,222 (GRCm39) splice site probably benign
R1621:Snx7 UTSW 3 117,630,805 (GRCm39) missense possibly damaging 0.89
R1911:Snx7 UTSW 3 117,623,317 (GRCm39) splice site probably null
R1912:Snx7 UTSW 3 117,623,317 (GRCm39) splice site probably null
R4663:Snx7 UTSW 3 117,594,528 (GRCm39) missense probably benign 0.00
R5182:Snx7 UTSW 3 117,626,506 (GRCm39) missense probably damaging 1.00
R5681:Snx7 UTSW 3 117,640,272 (GRCm39) missense probably benign 0.10
R6397:Snx7 UTSW 3 117,640,272 (GRCm39) missense probably benign 0.10
R6715:Snx7 UTSW 3 117,575,985 (GRCm39) missense possibly damaging 0.47
R6901:Snx7 UTSW 3 117,623,285 (GRCm39) nonsense probably null
R6996:Snx7 UTSW 3 117,640,281 (GRCm39) missense possibly damaging 0.82
R7049:Snx7 UTSW 3 117,633,680 (GRCm39) missense possibly damaging 0.57
R7372:Snx7 UTSW 3 117,576,000 (GRCm39) missense probably damaging 1.00
R7429:Snx7 UTSW 3 117,630,861 (GRCm39) missense probably benign 0.00
R7741:Snx7 UTSW 3 117,632,488 (GRCm39) missense probably damaging 1.00
R8025:Snx7 UTSW 3 117,626,526 (GRCm39) missense probably benign
R8098:Snx7 UTSW 3 117,632,583 (GRCm39) missense probably benign 0.00
R8125:Snx7 UTSW 3 117,630,894 (GRCm39) missense probably damaging 0.96
R9400:Snx7 UTSW 3 117,630,863 (GRCm39) missense probably benign 0.04
R9501:Snx7 UTSW 3 117,632,611 (GRCm39) missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GGATACTAAAGGGCCTGCTG -3'
(R):5'- TACAGAGAGCAGCAGGGTTC -3'

Sequencing Primer
(F):5'- AGAACCATTTACCTCGGCCTGTG -3'
(R):5'- CAGGGTTCCTAGGAGCATTTGTATAC -3'
Posted On 2015-03-25