Mutagenetix > Incidental Mutation

Incidental Mutation 'R3788:Hnrnpr'

272367

Institutional Source

Beutler Lab

Gene Symbol

Hnrnpr

Ensembl Gene

ENSMUSG00000066037

Gene Name

heterogeneous nuclear ribonucleoprotein R

Synonyms

hnRNPR, Hnrpr, 2610528B01Rik, 2610003J05Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3788 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136310942-136359447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 136336313 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 345 (V345M)

Ref Sequence

ENSEMBL: ENSMUSP00000138399 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084219] [ENSMUST00000105850] [ENSMUST00000131671] [ENSMUST00000148843]

AlphaFold

Q8VHM5

Predicted Effect

probably damaging
Transcript: ENSMUST00000084219
AA Change: V244M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081239
Gene: ENSMUSG00000066037
AA Change: V244M

Domain	Start	End	E-Value	Type
RRM	166	240	1.27e-16	SMART
RRM	247	324	9.42e-11	SMART
RRM	342	407	3.76e-19	SMART
low complexity region	419	428	N/A	INTRINSIC
low complexity region	433	496	N/A	INTRINSIC
low complexity region	499	527	N/A	INTRINSIC
low complexity region	531	574	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105850
AA Change: V345M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101476
Gene: ENSMUSG00000066037
AA Change: V345M

Domain	Start	End	E-Value	Type
RRM	166	240	1.27e-16	SMART
RRM	247	324	9.42e-11	SMART
RRM	342	407	3.76e-19	SMART
low complexity region	419	428	N/A	INTRINSIC
low complexity region	433	496	N/A	INTRINSIC
low complexity region	499	527	N/A	INTRINSIC
low complexity region	531	574	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000131671
AA Change: V244M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138263
Gene: ENSMUSG00000066037
AA Change: V244M

Domain	Start	End	E-Value	Type
RRM	65	139	1.27e-16	SMART
RRM	146	223	9.42e-11	SMART
RRM	241	306	3.76e-19	SMART
low complexity region	318	327	N/A	INTRINSIC
low complexity region	332	395	N/A	INTRINSIC
low complexity region	398	426	N/A	INTRINSIC
low complexity region	430	473	N/A	INTRINSIC
low complexity region	503	519	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000148843
AA Change: V345M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138399
Gene: ENSMUSG00000066037
AA Change: V345M

Domain	Start	End	E-Value	Type
RRM	166	240	1.27e-16	SMART
RRM	247	324	9.42e-11	SMART
RRM	342	407	3.76e-19	SMART
low complexity region	419	428	N/A	INTRINSIC
low complexity region	433	496	N/A	INTRINSIC
low complexity region	499	527	N/A	INTRINSIC
low complexity region	531	574	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153505

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182327

Meta Mutation Damage Score

0.9092

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is a member of the spliceosome C complex, which functions in pre-mRNA processing and transport. The encoded protein also promotes transcription at the c-fos gene. Alternative splicing results in multiple transcript variants. There are pseudogenes for this gene on chromosomes 4, 11, and 10. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,288,297		probably null	Het
Abca4	T	A	3: 122,052,912	V26E	possibly damaging	Het
Abhd16a	A	G	17: 35,101,587	N411S	probably damaging	Het
Akap13	G	A	7: 75,702,153		probably null	Het
Aph1b	T	C	9: 66,794,066		probably benign	Het
Aspm	C	T	1: 139,463,203	T742I	probably damaging	Het
Bclaf3	A	G	X: 159,566,496	H619R	probably benign	Het
Cemip	A	T	7: 83,943,898	L1199H	probably damaging	Het
Chd2	G	A	7: 73,447,130		probably benign	Het
Clnk	A	G	5: 38,714,998	Y310H	probably damaging	Het
Crmp1	A	G	5: 37,284,140	D522G	probably damaging	Het
Cyth3	A	G	5: 143,636,543		probably benign	Het
Dcbld1	T	A	10: 52,319,658	Y392N	probably damaging	Het
Fam60a	A	G	6: 148,926,119	S134P	possibly damaging	Het
Flnc	T	C	6: 29,454,057	F1820L	probably damaging	Het
Galnt18	G	A	7: 111,520,115	R385*	probably null	Het
Gpatch3	C	A	4: 133,575,168	R137S	possibly damaging	Het
Gpc6	C	T	14: 117,624,466	P265S	probably damaging	Het
Harbi1	T	A	2: 91,720,607	D308E	probably benign	Het
Hdhd2	G	A	18: 76,955,187		probably null	Het
Hk1	T	C	10: 62,275,688	K737E	possibly damaging	Het
Kalrn	T	C	16: 34,220,240	H944R	probably damaging	Het
Kdm2a	A	T	19: 4,351,805	C207S	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt75	C	T	15: 101,573,521	G104D	possibly damaging	Het
Lnpk	A	T	2: 74,522,263	S358R	probably benign	Het
Map2	A	G	1: 66,416,863	T1512A	probably damaging	Het
March10	T	A	11: 105,397,079	L132F	probably damaging	Het
Mfrp	G	A	9: 44,105,457	W65*	probably null	Het
Mgat5	A	G	1: 127,366,443	D174G	probably benign	Het
Miga2	T	A	2: 30,371,225	Y177*	probably null	Het
Mroh3	T	C	1: 136,185,475	D747G	probably damaging	Het
Muc5b	A	G	7: 141,863,834	T3506A	possibly damaging	Het
Myo7b	G	T	18: 31,974,112	P1277T	possibly damaging	Het
Naaa	C	T	5: 92,272,554		probably null	Het
Ndufs2	T	C	1: 171,235,320	D410G	possibly damaging	Het
Olfr506	T	A	7: 108,613,073	Y255*	probably null	Het
Olfr559	A	G	7: 102,723,487		probably null	Het
Olfr873	A	G	9: 20,300,370	I58V	probably benign	Het
Olfr955	A	G	9: 39,470,069	I219T	probably benign	Het
Osbp	A	T	19: 11,978,921	Y409F	probably benign	Het
Plxnb1	T	A	9: 109,109,287	V1303D	possibly damaging	Het
Prkcg	G	A	7: 3,313,747	D246N	probably damaging	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,219,203		probably benign	Het
Sbf1	G	A	15: 89,299,528	R1261*	probably null	Het
Scn4a	T	C	11: 106,344,274	N341S	probably damaging	Het
Sec61a2	C	A	2: 5,879,625		probably null	Het
Sgcd	T	A	11: 47,355,205	K57*	probably null	Het
Slc12a5	T	C	2: 164,993,775	L861P	probably damaging	Het
Slc6a16	A	G	7: 45,259,962	D184G	probably benign	Het
Snx7	A	G	3: 117,838,990		probably benign	Het
Sptbn2	A	G	19: 4,745,922	I1710V	probably damaging	Het
Sytl2	A	T	7: 90,376,081	I426F	probably benign	Het
Tdp1	A	G	12: 99,891,752		probably benign	Het
Tmem232	C	A	17: 65,382,633	D496Y	possibly damaging	Het
Tomm20l	C	T	12: 71,111,742	A58V	possibly damaging	Het
Ttc26	T	A	6: 38,403,524		probably null	Het
Ttn	T	C	2: 76,945,274	E1854G	unknown	Het
Ttn	A	G	2: 76,974,208	V240A	probably benign	Het
Vmn2r98	A	T	17: 19,080,625	T630S	probably benign	Het
Xrcc1	G	C	7: 24,566,908	A220P	probably benign	Het

Other mutations in Hnrnpr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Hnrnpr	APN	4	136339545	missense	unknown
IGL00844:Hnrnpr	APN	4	136339205	missense	probably benign	0.17
IGL01374:Hnrnpr	APN	4	136327418	splice site	probably benign
IGL01704:Hnrnpr	APN	4	136329381	missense	possibly damaging	0.89
IGL01825:Hnrnpr	APN	4	136339539	nonsense	probably null
IGL01843:Hnrnpr	APN	4	136339413	splice site	probably benign
IGL01871:Hnrnpr	APN	4	136339574	missense	unknown
IGL02376:Hnrnpr	APN	4	136319455	missense	probably damaging	1.00
IGL02557:Hnrnpr	APN	4	136319506	missense	probably damaging	1.00
IGL02947:Hnrnpr	APN	4	136316379	missense	probably damaging	1.00
PIT4677001:Hnrnpr	UTSW	4	136329439	missense	probably damaging	1.00
R0142:Hnrnpr	UTSW	4	136327282	missense	probably damaging	1.00
R0219:Hnrnpr	UTSW	4	136339163	splice site	probably benign
R1459:Hnrnpr	UTSW	4	136329444	missense	probably damaging	1.00
R1917:Hnrnpr	UTSW	4	136332488	nonsense	probably null
R2007:Hnrnpr	UTSW	4	136319513	unclassified	probably benign
R2364:Hnrnpr	UTSW	4	136327329	missense	possibly damaging	0.69
R4066:Hnrnpr	UTSW	4	136339346	intron	probably benign
R4232:Hnrnpr	UTSW	4	136339189	missense	probably benign	0.15
R4433:Hnrnpr	UTSW	4	136317148	missense	probably benign	0.04
R4664:Hnrnpr	UTSW	4	136317175	unclassified	probably benign
R4990:Hnrnpr	UTSW	4	136329379	missense	probably damaging	1.00
R4990:Hnrnpr	UTSW	4	136336298	missense	probably damaging	1.00
R5058:Hnrnpr	UTSW	4	136336337	missense	possibly damaging	0.89
R5328:Hnrnpr	UTSW	4	136339216	missense	probably benign	0.01
R5469:Hnrnpr	UTSW	4	136319434	missense	probably damaging	1.00
R5641:Hnrnpr	UTSW	4	136332487	missense	probably damaging	0.97
R7067:Hnrnpr	UTSW	4	136327393	missense	probably damaging	1.00
R7250:Hnrnpr	UTSW	4	136332435	missense	probably benign	0.45
R7254:Hnrnpr	UTSW	4	136332575	missense	possibly damaging	0.92
R8213:Hnrnpr	UTSW	4	136317175	unclassified	probably benign
R8942:Hnrnpr	UTSW	4	136332480	missense	possibly damaging	0.95
R9008:Hnrnpr	UTSW	4	136329426	missense	probably damaging	0.97
R9502:Hnrnpr	UTSW	4	136329370	missense	probably damaging	0.99
R9515:Hnrnpr	UTSW	4	136336304	missense	probably damaging	1.00
R9516:Hnrnpr	UTSW	4	136336304	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTAACTGTTCCCTTGGGAC -3'
(R):5'- GGTTCAGACTCCAGCAACTTAC -3'

Sequencing Primer
(F):5'- TGGGACAAAAGGCAAGAGC -3'
(R):5'- CTGCAGCTCTAGAGAATCCAGTG -3'

Posted On

2015-03-25