Incidental Mutation 'R3788:Xrcc1'
ID 272375
Institutional Source Beutler Lab
Gene Symbol Xrcc1
Ensembl Gene ENSMUSG00000051768
Gene Name X-ray repair complementing defective repair in Chinese hamster cells 1
Synonyms Xrcc-1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3788 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 24246124-24272863 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 24266333 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Proline at position 220 (A220P)
Ref Sequence ENSEMBL: ENSMUSP00000146105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063249] [ENSMUST00000205573]
AlphaFold Q60596
Predicted Effect probably benign
Transcript: ENSMUST00000063249
AA Change: A220P

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000070995
Gene: ENSMUSG00000051768
AA Change: A220P

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 151 6.9e-66 PFAM
low complexity region 212 238 N/A INTRINSIC
low complexity region 278 294 N/A INTRINSIC
BRCT 317 393 8e-19 SMART
low complexity region 407 424 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
BRCT 538 617 5.5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205564
Predicted Effect probably benign
Transcript: ENSMUST00000205573
AA Change: A220P

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206153
Meta Mutation Damage Score 0.0976 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the efficient repair of DNA single-strand breaks formed by exposure to ionizing radiation and alkylating agents. This protein interacts with DNA ligase III, polymerase beta and poly (ADP-ribose) polymerase to participate in the base excision repair pathway. It may play a role in DNA processing during meiogenesis and recombination in germ cells. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants accumulate unrepaired DNA strand breaks in the egg cylinder, show increased cell death in epiblast, developmental arrest at embryonic day 6.5, morphological anomalies in visceral embryonic endoderm by day 7.5 and die by day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,846,561 (GRCm39) V26E possibly damaging Het
Abhd16a A G 17: 35,320,563 (GRCm39) N411S probably damaging Het
Akap13 G A 7: 75,351,901 (GRCm39) probably null Het
Aph1b T C 9: 66,701,348 (GRCm39) probably benign Het
Aspm C T 1: 139,390,941 (GRCm39) T742I probably damaging Het
Bclaf3 A G X: 158,349,492 (GRCm39) H619R probably benign Het
Bltp2 T A 11: 78,179,123 (GRCm39) probably null Het
Cemip A T 7: 83,593,106 (GRCm39) L1199H probably damaging Het
Chd2 G A 7: 73,096,878 (GRCm39) probably benign Het
Clnk A G 5: 38,872,341 (GRCm39) Y310H probably damaging Het
Crmp1 A G 5: 37,441,484 (GRCm39) D522G probably damaging Het
Cyth3 A G 5: 143,622,298 (GRCm39) probably benign Het
Dcbld1 T A 10: 52,195,754 (GRCm39) Y392N probably damaging Het
Flnc T C 6: 29,454,056 (GRCm39) F1820L probably damaging Het
Galnt18 G A 7: 111,119,322 (GRCm39) R385* probably null Het
Gpatch3 C A 4: 133,302,479 (GRCm39) R137S possibly damaging Het
Gpc6 C T 14: 117,861,878 (GRCm39) P265S probably damaging Het
Harbi1 T A 2: 91,550,952 (GRCm39) D308E probably benign Het
Hdhd2 G A 18: 77,042,883 (GRCm39) probably null Het
Hk1 T C 10: 62,111,467 (GRCm39) K737E possibly damaging Het
Hnrnpr G A 4: 136,063,624 (GRCm39) V345M probably damaging Het
Ift56 T A 6: 38,380,459 (GRCm39) probably null Het
Kalrn T C 16: 34,040,610 (GRCm39) H944R probably damaging Het
Kdm2a A T 19: 4,401,833 (GRCm39) C207S probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt75 C T 15: 101,481,956 (GRCm39) G104D possibly damaging Het
Lnpk A T 2: 74,352,607 (GRCm39) S358R probably benign Het
Map2 A G 1: 66,456,022 (GRCm39) T1512A probably damaging Het
Marchf10 T A 11: 105,287,905 (GRCm39) L132F probably damaging Het
Mfrp G A 9: 44,016,754 (GRCm39) W65* probably null Het
Mgat5 A G 1: 127,294,180 (GRCm39) D174G probably benign Het
Miga2 T A 2: 30,261,237 (GRCm39) Y177* probably null Het
Mroh3 T C 1: 136,113,213 (GRCm39) D747G probably damaging Het
Muc5b A G 7: 141,417,571 (GRCm39) T3506A possibly damaging Het
Myo7b G T 18: 32,107,165 (GRCm39) P1277T possibly damaging Het
Naaa C T 5: 92,420,413 (GRCm39) probably null Het
Ndufs2 T C 1: 171,062,889 (GRCm39) D410G possibly damaging Het
Or51a25 A G 7: 102,372,694 (GRCm39) probably null Het
Or5p78 T A 7: 108,212,280 (GRCm39) Y255* probably null Het
Or7e177 A G 9: 20,211,666 (GRCm39) I58V probably benign Het
Or8g35 A G 9: 39,381,365 (GRCm39) I219T probably benign Het
Osbp A T 19: 11,956,285 (GRCm39) Y409F probably benign Het
Plxnb1 T A 9: 108,938,355 (GRCm39) V1303D possibly damaging Het
Prkcg G A 7: 3,362,263 (GRCm39) D246N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,169,203 (GRCm39) probably benign Het
Sbf1 G A 15: 89,183,731 (GRCm39) R1261* probably null Het
Scn4a T C 11: 106,235,100 (GRCm39) N341S probably damaging Het
Sec61a2 C A 2: 5,884,436 (GRCm39) probably null Het
Sgcd T A 11: 47,246,032 (GRCm39) K57* probably null Het
Sinhcaf A G 6: 148,827,617 (GRCm39) S134P possibly damaging Het
Slc12a5 T C 2: 164,835,695 (GRCm39) L861P probably damaging Het
Slc6a16 A G 7: 44,909,386 (GRCm39) D184G probably benign Het
Snx7 A G 3: 117,632,639 (GRCm39) probably benign Het
Sptbn2 A G 19: 4,795,950 (GRCm39) I1710V probably damaging Het
Sytl2 A T 7: 90,025,289 (GRCm39) I426F probably benign Het
Tdp1 A G 12: 99,858,011 (GRCm39) probably benign Het
Tmem232 C A 17: 65,689,628 (GRCm39) D496Y possibly damaging Het
Tomm20l C T 12: 71,158,516 (GRCm39) A58V possibly damaging Het
Ttn T C 2: 76,775,618 (GRCm39) E1854G unknown Het
Ttn A G 2: 76,804,552 (GRCm39) V240A probably benign Het
Vmn2r98 A T 17: 19,300,887 (GRCm39) T630S probably benign Het
Other mutations in Xrcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Xrcc1 APN 7 24,247,309 (GRCm39) critical splice donor site probably null
IGL01830:Xrcc1 APN 7 24,272,767 (GRCm39) utr 3 prime probably benign
IGL02349:Xrcc1 APN 7 24,266,467 (GRCm39) nonsense probably null
IGL02433:Xrcc1 APN 7 24,264,979 (GRCm39) missense possibly damaging 0.96
IGL03131:Xrcc1 APN 7 24,272,719 (GRCm39) nonsense probably null
Bilberry UTSW 7 24,269,643 (GRCm39) missense probably damaging 1.00
R0090:Xrcc1 UTSW 7 24,269,642 (GRCm39) missense probably damaging 0.99
R0517:Xrcc1 UTSW 7 24,269,744 (GRCm39) splice site probably benign
R0612:Xrcc1 UTSW 7 24,269,744 (GRCm39) splice site probably benign
R1234:Xrcc1 UTSW 7 24,267,270 (GRCm39) missense possibly damaging 0.71
R1577:Xrcc1 UTSW 7 24,265,052 (GRCm39) nonsense probably null
R1796:Xrcc1 UTSW 7 24,247,252 (GRCm39) missense probably damaging 1.00
R1863:Xrcc1 UTSW 7 24,270,000 (GRCm39) missense possibly damaging 0.65
R3794:Xrcc1 UTSW 7 24,269,985 (GRCm39) missense probably benign 0.05
R4806:Xrcc1 UTSW 7 24,269,905 (GRCm39) missense probably benign 0.14
R5206:Xrcc1 UTSW 7 24,266,988 (GRCm39) missense probably damaging 1.00
R5414:Xrcc1 UTSW 7 24,269,643 (GRCm39) missense probably damaging 1.00
R5532:Xrcc1 UTSW 7 24,267,353 (GRCm39) critical splice donor site probably null
R5624:Xrcc1 UTSW 7 24,259,270 (GRCm39) missense possibly damaging 0.57
R5990:Xrcc1 UTSW 7 24,267,293 (GRCm39) missense probably damaging 1.00
R6603:Xrcc1 UTSW 7 24,270,459 (GRCm39) nonsense probably null
R6669:Xrcc1 UTSW 7 24,246,762 (GRCm39) missense probably damaging 1.00
R6716:Xrcc1 UTSW 7 24,266,571 (GRCm39) critical splice donor site probably null
R6881:Xrcc1 UTSW 7 24,246,776 (GRCm39) nonsense probably null
R7227:Xrcc1 UTSW 7 24,246,757 (GRCm39) missense probably damaging 1.00
R8204:Xrcc1 UTSW 7 24,271,709 (GRCm39) missense possibly damaging 0.88
R8284:Xrcc1 UTSW 7 24,271,703 (GRCm39) missense probably damaging 1.00
R8285:Xrcc1 UTSW 7 24,271,703 (GRCm39) missense probably damaging 1.00
R8287:Xrcc1 UTSW 7 24,271,703 (GRCm39) missense probably damaging 1.00
R9015:Xrcc1 UTSW 7 24,271,642 (GRCm39) missense probably benign 0.05
R9607:Xrcc1 UTSW 7 24,265,690 (GRCm39) missense probably benign 0.17
X0019:Xrcc1 UTSW 7 24,272,553 (GRCm39) missense probably damaging 1.00
X0024:Xrcc1 UTSW 7 24,272,504 (GRCm39) missense probably damaging 1.00
Z1176:Xrcc1 UTSW 7 24,247,264 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGGGGTACAATCTAAACTTCTGGG -3'
(R):5'- CCAGGGTCACTACAGAATCAAGG -3'

Sequencing Primer
(F):5'- GGTACAATCTAAACTTCTGGGTCACC -3'
(R):5'- CAGAATCAAGGAATCCAGTTTGC -3'
Posted On 2015-03-25