Incidental Mutation 'R3788:Chd2'
ID 272377
Institutional Source Beutler Lab
Gene Symbol Chd2
Ensembl Gene ENSMUSG00000078671
Gene Name chromodomain helicase DNA binding protein 2
Synonyms 5630401D06Rik, 2810013C04Rik, 2810040A01Rik
Accession Numbers
Essential gene? Possibly essential (E-score: 0.613) question?
Stock # R3788 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 73076400-73191494 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 73096878 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000169922] [ENSMUST00000181971]
AlphaFold E9PZM4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038366
Predicted Effect probably benign
Transcript: ENSMUST00000169922
SMART Domains Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
CHROMO 260 346 3.64e-19 SMART
CHROMO 376 449 7.99e-16 SMART
DEXDc 480 677 1.93e-37 SMART
Blast:DEXDc 678 729 2e-18 BLAST
low complexity region 793 806 N/A INTRINSIC
HELICc 821 905 1.2e-24 SMART
Blast:DEXDc 960 1244 4e-63 BLAST
PDB:4B4C|A 1128 1316 5e-78 PDB
low complexity region 1317 1329 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
low complexity region 1389 1403 N/A INTRINSIC
low complexity region 1407 1441 N/A INTRINSIC
DUF4208 1451 1555 1.85e-52 SMART
low complexity region 1557 1572 N/A INTRINSIC
low complexity region 1704 1729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173785
SMART Domains Protein: ENSMUSP00000133714
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
DUF4208 1 58 1.59e-4 SMART
low complexity region 60 75 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181971
Predicted Effect probably benign
Transcript: ENSMUST00000199809
Predicted Effect probably benign
Transcript: ENSMUST00000208458
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]
Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,846,561 (GRCm39) V26E possibly damaging Het
Abhd16a A G 17: 35,320,563 (GRCm39) N411S probably damaging Het
Akap13 G A 7: 75,351,901 (GRCm39) probably null Het
Aph1b T C 9: 66,701,348 (GRCm39) probably benign Het
Aspm C T 1: 139,390,941 (GRCm39) T742I probably damaging Het
Bclaf3 A G X: 158,349,492 (GRCm39) H619R probably benign Het
Bltp2 T A 11: 78,179,123 (GRCm39) probably null Het
Cemip A T 7: 83,593,106 (GRCm39) L1199H probably damaging Het
Clnk A G 5: 38,872,341 (GRCm39) Y310H probably damaging Het
Crmp1 A G 5: 37,441,484 (GRCm39) D522G probably damaging Het
Cyth3 A G 5: 143,622,298 (GRCm39) probably benign Het
Dcbld1 T A 10: 52,195,754 (GRCm39) Y392N probably damaging Het
Flnc T C 6: 29,454,056 (GRCm39) F1820L probably damaging Het
Galnt18 G A 7: 111,119,322 (GRCm39) R385* probably null Het
Gpatch3 C A 4: 133,302,479 (GRCm39) R137S possibly damaging Het
Gpc6 C T 14: 117,861,878 (GRCm39) P265S probably damaging Het
Harbi1 T A 2: 91,550,952 (GRCm39) D308E probably benign Het
Hdhd2 G A 18: 77,042,883 (GRCm39) probably null Het
Hk1 T C 10: 62,111,467 (GRCm39) K737E possibly damaging Het
Hnrnpr G A 4: 136,063,624 (GRCm39) V345M probably damaging Het
Ift56 T A 6: 38,380,459 (GRCm39) probably null Het
Kalrn T C 16: 34,040,610 (GRCm39) H944R probably damaging Het
Kdm2a A T 19: 4,401,833 (GRCm39) C207S probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt75 C T 15: 101,481,956 (GRCm39) G104D possibly damaging Het
Lnpk A T 2: 74,352,607 (GRCm39) S358R probably benign Het
Map2 A G 1: 66,456,022 (GRCm39) T1512A probably damaging Het
Marchf10 T A 11: 105,287,905 (GRCm39) L132F probably damaging Het
Mfrp G A 9: 44,016,754 (GRCm39) W65* probably null Het
Mgat5 A G 1: 127,294,180 (GRCm39) D174G probably benign Het
Miga2 T A 2: 30,261,237 (GRCm39) Y177* probably null Het
Mroh3 T C 1: 136,113,213 (GRCm39) D747G probably damaging Het
Muc5b A G 7: 141,417,571 (GRCm39) T3506A possibly damaging Het
Myo7b G T 18: 32,107,165 (GRCm39) P1277T possibly damaging Het
Naaa C T 5: 92,420,413 (GRCm39) probably null Het
Ndufs2 T C 1: 171,062,889 (GRCm39) D410G possibly damaging Het
Or51a25 A G 7: 102,372,694 (GRCm39) probably null Het
Or5p78 T A 7: 108,212,280 (GRCm39) Y255* probably null Het
Or7e177 A G 9: 20,211,666 (GRCm39) I58V probably benign Het
Or8g35 A G 9: 39,381,365 (GRCm39) I219T probably benign Het
Osbp A T 19: 11,956,285 (GRCm39) Y409F probably benign Het
Plxnb1 T A 9: 108,938,355 (GRCm39) V1303D possibly damaging Het
Prkcg G A 7: 3,362,263 (GRCm39) D246N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,169,203 (GRCm39) probably benign Het
Sbf1 G A 15: 89,183,731 (GRCm39) R1261* probably null Het
Scn4a T C 11: 106,235,100 (GRCm39) N341S probably damaging Het
Sec61a2 C A 2: 5,884,436 (GRCm39) probably null Het
Sgcd T A 11: 47,246,032 (GRCm39) K57* probably null Het
Sinhcaf A G 6: 148,827,617 (GRCm39) S134P possibly damaging Het
Slc12a5 T C 2: 164,835,695 (GRCm39) L861P probably damaging Het
Slc6a16 A G 7: 44,909,386 (GRCm39) D184G probably benign Het
Snx7 A G 3: 117,632,639 (GRCm39) probably benign Het
Sptbn2 A G 19: 4,795,950 (GRCm39) I1710V probably damaging Het
Sytl2 A T 7: 90,025,289 (GRCm39) I426F probably benign Het
Tdp1 A G 12: 99,858,011 (GRCm39) probably benign Het
Tmem232 C A 17: 65,689,628 (GRCm39) D496Y possibly damaging Het
Tomm20l C T 12: 71,158,516 (GRCm39) A58V possibly damaging Het
Ttn T C 2: 76,775,618 (GRCm39) E1854G unknown Het
Ttn A G 2: 76,804,552 (GRCm39) V240A probably benign Het
Vmn2r98 A T 17: 19,300,887 (GRCm39) T630S probably benign Het
Xrcc1 G C 7: 24,266,333 (GRCm39) A220P probably benign Het
Other mutations in Chd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Chd2 APN 7 73,118,325 (GRCm39) missense probably damaging 0.99
IGL00535:Chd2 APN 7 73,190,576 (GRCm39) missense probably benign 0.01
IGL00961:Chd2 APN 7 73,093,997 (GRCm39) missense probably damaging 0.99
IGL01092:Chd2 APN 7 73,091,434 (GRCm39) missense possibly damaging 0.69
IGL02035:Chd2 APN 7 73,091,375 (GRCm39) splice site probably null
IGL02083:Chd2 APN 7 73,130,816 (GRCm39) missense possibly damaging 0.95
IGL02205:Chd2 APN 7 73,091,465 (GRCm39) missense probably benign 0.01
IGL02243:Chd2 APN 7 73,147,456 (GRCm39) splice site probably null
IGL02385:Chd2 APN 7 73,085,570 (GRCm39) missense probably damaging 1.00
IGL02552:Chd2 APN 7 73,097,068 (GRCm39) unclassified probably benign
IGL02590:Chd2 APN 7 73,102,948 (GRCm39) missense probably benign 0.00
IGL02684:Chd2 APN 7 73,125,097 (GRCm39) missense probably damaging 0.99
IGL02731:Chd2 APN 7 73,143,204 (GRCm39) missense probably damaging 0.99
IGL03272:Chd2 APN 7 73,102,914 (GRCm39) missense possibly damaging 0.94
1mM(1):Chd2 UTSW 7 73,151,852 (GRCm39) missense possibly damaging 0.65
A4554:Chd2 UTSW 7 73,130,716 (GRCm39) missense probably benign
F6893:Chd2 UTSW 7 73,157,620 (GRCm39) missense possibly damaging 0.92
R0012:Chd2 UTSW 7 73,105,267 (GRCm39) missense probably damaging 1.00
R0012:Chd2 UTSW 7 73,105,267 (GRCm39) missense probably damaging 1.00
R0068:Chd2 UTSW 7 73,134,282 (GRCm39) missense probably damaging 1.00
R0763:Chd2 UTSW 7 73,097,022 (GRCm39) missense possibly damaging 0.74
R0973:Chd2 UTSW 7 73,128,412 (GRCm39) missense probably damaging 1.00
R0973:Chd2 UTSW 7 73,128,412 (GRCm39) missense probably damaging 1.00
R0974:Chd2 UTSW 7 73,128,412 (GRCm39) missense probably damaging 1.00
R1223:Chd2 UTSW 7 73,134,265 (GRCm39) missense probably damaging 1.00
R1435:Chd2 UTSW 7 73,102,884 (GRCm39) missense probably damaging 0.99
R1527:Chd2 UTSW 7 73,140,362 (GRCm39) nonsense probably null
R1599:Chd2 UTSW 7 73,122,799 (GRCm39) missense probably benign 0.05
R1657:Chd2 UTSW 7 73,130,178 (GRCm39) missense probably damaging 1.00
R1932:Chd2 UTSW 7 73,104,193 (GRCm39) missense probably damaging 0.99
R2110:Chd2 UTSW 7 73,079,735 (GRCm39) missense probably benign 0.00
R2202:Chd2 UTSW 7 73,128,416 (GRCm39) missense probably benign 0.00
R2383:Chd2 UTSW 7 73,153,168 (GRCm39) missense possibly damaging 0.89
R2393:Chd2 UTSW 7 73,157,631 (GRCm39) missense possibly damaging 0.92
R3699:Chd2 UTSW 7 73,118,238 (GRCm39) missense probably benign 0.35
R3713:Chd2 UTSW 7 73,121,538 (GRCm39) unclassified probably benign
R3826:Chd2 UTSW 7 73,141,163 (GRCm39) missense possibly damaging 0.71
R3828:Chd2 UTSW 7 73,141,163 (GRCm39) missense possibly damaging 0.71
R3830:Chd2 UTSW 7 73,141,163 (GRCm39) missense possibly damaging 0.71
R3966:Chd2 UTSW 7 73,114,143 (GRCm39) splice site probably benign
R4093:Chd2 UTSW 7 73,150,764 (GRCm39) missense possibly damaging 0.70
R4431:Chd2 UTSW 7 73,085,709 (GRCm39) missense possibly damaging 0.56
R4461:Chd2 UTSW 7 73,190,622 (GRCm39) intron probably benign
R4782:Chd2 UTSW 7 73,134,184 (GRCm39) missense possibly damaging 0.80
R4791:Chd2 UTSW 7 73,118,325 (GRCm39) missense probably benign 0.13
R4792:Chd2 UTSW 7 73,118,325 (GRCm39) missense probably benign 0.13
R4799:Chd2 UTSW 7 73,134,184 (GRCm39) missense possibly damaging 0.80
R4832:Chd2 UTSW 7 73,151,873 (GRCm39) missense probably damaging 1.00
R5055:Chd2 UTSW 7 73,130,256 (GRCm39) missense probably damaging 1.00
R5071:Chd2 UTSW 7 73,079,437 (GRCm39) missense probably benign 0.03
R5328:Chd2 UTSW 7 73,113,429 (GRCm39) missense possibly damaging 0.96
R5444:Chd2 UTSW 7 73,122,833 (GRCm39) missense probably damaging 1.00
R5643:Chd2 UTSW 7 73,134,232 (GRCm39) missense probably damaging 1.00
R5666:Chd2 UTSW 7 73,091,465 (GRCm39) missense probably benign 0.01
R5670:Chd2 UTSW 7 73,091,465 (GRCm39) missense probably benign 0.01
R5706:Chd2 UTSW 7 73,141,105 (GRCm39) missense possibly damaging 0.74
R5825:Chd2 UTSW 7 73,134,350 (GRCm39) splice site probably null
R5834:Chd2 UTSW 7 73,128,463 (GRCm39) missense probably damaging 1.00
R5920:Chd2 UTSW 7 73,187,060 (GRCm39) missense probably damaging 0.97
R6051:Chd2 UTSW 7 73,085,590 (GRCm39) missense probably benign 0.00
R6179:Chd2 UTSW 7 73,094,071 (GRCm39) missense probably damaging 0.98
R6229:Chd2 UTSW 7 73,101,471 (GRCm39) missense possibly damaging 0.76
R6267:Chd2 UTSW 7 73,113,419 (GRCm39) missense probably damaging 0.99
R6310:Chd2 UTSW 7 73,102,912 (GRCm39) missense probably damaging 1.00
R6439:Chd2 UTSW 7 73,130,154 (GRCm39) missense probably damaging 1.00
R6444:Chd2 UTSW 7 73,150,785 (GRCm39) critical splice acceptor site probably null
R6529:Chd2 UTSW 7 73,153,191 (GRCm39) missense possibly damaging 0.89
R6611:Chd2 UTSW 7 73,143,313 (GRCm39) missense probably damaging 0.99
R6661:Chd2 UTSW 7 73,140,230 (GRCm39) missense possibly damaging 0.95
R6782:Chd2 UTSW 7 73,125,127 (GRCm39) nonsense probably null
R6860:Chd2 UTSW 7 73,147,558 (GRCm39) missense possibly damaging 0.95
R6955:Chd2 UTSW 7 73,125,171 (GRCm39) missense probably damaging 1.00
R6984:Chd2 UTSW 7 73,134,159 (GRCm39) nonsense probably null
R7095:Chd2 UTSW 7 73,121,629 (GRCm39) missense probably damaging 1.00
R7121:Chd2 UTSW 7 73,119,418 (GRCm39) missense probably benign 0.00
R7179:Chd2 UTSW 7 73,125,168 (GRCm39) missense probably damaging 1.00
R7500:Chd2 UTSW 7 73,101,556 (GRCm39) missense probably damaging 1.00
R7615:Chd2 UTSW 7 73,091,390 (GRCm39) missense probably damaging 0.97
R7646:Chd2 UTSW 7 73,085,521 (GRCm39) missense possibly damaging 0.49
R7764:Chd2 UTSW 7 73,121,567 (GRCm39) missense probably null 1.00
R7898:Chd2 UTSW 7 73,169,223 (GRCm39) critical splice donor site probably null
R7935:Chd2 UTSW 7 73,149,373 (GRCm39) missense probably benign 0.01
R8033:Chd2 UTSW 7 73,085,628 (GRCm39) missense probably damaging 1.00
R8070:Chd2 UTSW 7 73,101,506 (GRCm39) missense probably benign
R8071:Chd2 UTSW 7 73,187,132 (GRCm39) missense probably benign
R8188:Chd2 UTSW 7 73,079,504 (GRCm39) nonsense probably null
R8196:Chd2 UTSW 7 73,118,285 (GRCm39) missense probably benign 0.00
R8258:Chd2 UTSW 7 73,085,532 (GRCm39) missense probably benign 0.11
R8259:Chd2 UTSW 7 73,085,532 (GRCm39) missense probably benign 0.11
R8357:Chd2 UTSW 7 73,096,985 (GRCm39) missense probably damaging 0.99
R8457:Chd2 UTSW 7 73,096,985 (GRCm39) missense probably damaging 0.99
R8778:Chd2 UTSW 7 73,079,483 (GRCm39) missense possibly damaging 0.88
R8816:Chd2 UTSW 7 73,140,245 (GRCm39) missense probably damaging 1.00
R8875:Chd2 UTSW 7 73,151,783 (GRCm39) missense probably damaging 1.00
R8935:Chd2 UTSW 7 73,153,210 (GRCm39) missense possibly damaging 0.47
R9005:Chd2 UTSW 7 73,134,294 (GRCm39) missense probably damaging 0.98
R9009:Chd2 UTSW 7 73,143,192 (GRCm39) missense probably benign 0.39
R9009:Chd2 UTSW 7 73,140,402 (GRCm39) missense probably benign 0.12
R9021:Chd2 UTSW 7 73,091,393 (GRCm39) missense probably benign 0.03
R9038:Chd2 UTSW 7 73,105,358 (GRCm39) missense probably damaging 1.00
R9064:Chd2 UTSW 7 73,143,279 (GRCm39) missense possibly damaging 0.70
R9383:Chd2 UTSW 7 73,098,918 (GRCm39) missense probably null 1.00
R9501:Chd2 UTSW 7 73,130,294 (GRCm39) missense probably damaging 1.00
R9501:Chd2 UTSW 7 73,091,481 (GRCm39) missense possibly damaging 0.92
R9550:Chd2 UTSW 7 73,119,439 (GRCm39) missense probably damaging 0.99
R9583:Chd2 UTSW 7 73,130,230 (GRCm39) missense probably damaging 0.99
R9665:Chd2 UTSW 7 73,079,555 (GRCm39) missense probably benign 0.00
RF009:Chd2 UTSW 7 73,169,410 (GRCm39) missense possibly damaging 0.73
X0025:Chd2 UTSW 7 73,157,585 (GRCm39) missense probably benign 0.11
Z1177:Chd2 UTSW 7 73,118,334 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCAAAAGAAAAGGCTGGACTTTAC -3'
(R):5'- ACATGACTCATGCTCTTTTGGC -3'

Sequencing Primer
(F):5'- CAAAGTGGCTTATTTCATGAAAAGG -3'
(R):5'- CTTGTTGCAGTGTAAGGAGAGGATG -3'
Posted On 2015-03-25