Mutagenetix > Incidental Mutation

Incidental Mutation 'R3788:Akap13'

272378

Institutional Source

Beutler Lab

Gene Symbol

Akap13

Ensembl Gene

ENSMUSG00000066406

Gene Name

A kinase (PRKA) anchor protein 13

Synonyms

AKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3788 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75455534-75754609 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 75702153 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207239] [ENSMUST00000207750] [ENSMUST00000207923]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000094307

SMART Domains

Protein: ENSMUSP00000091865
Gene: ENSMUSG00000066406

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC
C1	54	100	1.95e-4	SMART
low complexity region	157	168	N/A	INTRINSIC
RhoGEF	260	452	1.28e-61	SMART
PH	494	597	2.94e-11	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000132656

Predicted Effect

probably benign
Transcript: ENSMUST00000166315

SMART Domains

Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
low complexity region	1433	1448	N/A	INTRINSIC
low complexity region	1483	1505	N/A	INTRINSIC
low complexity region	1583	1594	N/A	INTRINSIC
low complexity region	1720	1750	N/A	INTRINSIC
C1	1755	1801	1.95e-4	SMART
low complexity region	1858	1869	N/A	INTRINSIC
RhoGEF	1961	2153	1.28e-61	SMART
PH	2195	2298	2.94e-11	SMART
coiled coil region	2308	2345	N/A	INTRINSIC
low complexity region	2393	2412	N/A	INTRINSIC
low complexity region	2444	2454	N/A	INTRINSIC
coiled coil region	2533	2646	N/A	INTRINSIC
low complexity region	2728	2734	N/A	INTRINSIC
low complexity region	2740	2753	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000207239

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207511

Predicted Effect

probably benign
Transcript: ENSMUST00000207750

Predicted Effect

probably benign
Transcript: ENSMUST00000207923

Predicted Effect

probably benign
Transcript: ENSMUST00000207998

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208009

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208248

Predicted Effect

probably benign
Transcript: ENSMUST00000208708

Meta Mutation Damage Score

0.9487

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,288,297		probably null	Het
Abca4	T	A	3: 122,052,912	V26E	possibly damaging	Het
Abhd16a	A	G	17: 35,101,587	N411S	probably damaging	Het
Aph1b	T	C	9: 66,794,066		probably benign	Het
Aspm	C	T	1: 139,463,203	T742I	probably damaging	Het
Bclaf3	A	G	X: 159,566,496	H619R	probably benign	Het
Cemip	A	T	7: 83,943,898	L1199H	probably damaging	Het
Chd2	G	A	7: 73,447,130		probably benign	Het
Clnk	A	G	5: 38,714,998	Y310H	probably damaging	Het
Crmp1	A	G	5: 37,284,140	D522G	probably damaging	Het
Cyth3	A	G	5: 143,636,543		probably benign	Het
Dcbld1	T	A	10: 52,319,658	Y392N	probably damaging	Het
Fam60a	A	G	6: 148,926,119	S134P	possibly damaging	Het
Flnc	T	C	6: 29,454,057	F1820L	probably damaging	Het
Galnt18	G	A	7: 111,520,115	R385*	probably null	Het
Gpatch3	C	A	4: 133,575,168	R137S	possibly damaging	Het
Gpc6	C	T	14: 117,624,466	P265S	probably damaging	Het
Harbi1	T	A	2: 91,720,607	D308E	probably benign	Het
Hdhd2	G	A	18: 76,955,187		probably null	Het
Hk1	T	C	10: 62,275,688	K737E	possibly damaging	Het
Hnrnpr	G	A	4: 136,336,313	V345M	probably damaging	Het
Kalrn	T	C	16: 34,220,240	H944R	probably damaging	Het
Kdm2a	A	T	19: 4,351,805	C207S	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt75	C	T	15: 101,573,521	G104D	possibly damaging	Het
Lnpk	A	T	2: 74,522,263	S358R	probably benign	Het
Map2	A	G	1: 66,416,863	T1512A	probably damaging	Het
March10	T	A	11: 105,397,079	L132F	probably damaging	Het
Mfrp	G	A	9: 44,105,457	W65*	probably null	Het
Mgat5	A	G	1: 127,366,443	D174G	probably benign	Het
Miga2	T	A	2: 30,371,225	Y177*	probably null	Het
Mroh3	T	C	1: 136,185,475	D747G	probably damaging	Het
Muc5b	A	G	7: 141,863,834	T3506A	possibly damaging	Het
Myo7b	G	T	18: 31,974,112	P1277T	possibly damaging	Het
Naaa	C	T	5: 92,272,554		probably null	Het
Ndufs2	T	C	1: 171,235,320	D410G	possibly damaging	Het
Olfr506	T	A	7: 108,613,073	Y255*	probably null	Het
Olfr559	A	G	7: 102,723,487		probably null	Het
Olfr873	A	G	9: 20,300,370	I58V	probably benign	Het
Olfr955	A	G	9: 39,470,069	I219T	probably benign	Het
Osbp	A	T	19: 11,978,921	Y409F	probably benign	Het
Plxnb1	T	A	9: 109,109,287	V1303D	possibly damaging	Het
Prkcg	G	A	7: 3,313,747	D246N	probably damaging	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,219,203		probably benign	Het
Sbf1	G	A	15: 89,299,528	R1261*	probably null	Het
Scn4a	T	C	11: 106,344,274	N341S	probably damaging	Het
Sec61a2	C	A	2: 5,879,625		probably null	Het
Sgcd	T	A	11: 47,355,205	K57*	probably null	Het
Slc12a5	T	C	2: 164,993,775	L861P	probably damaging	Het
Slc6a16	A	G	7: 45,259,962	D184G	probably benign	Het
Snx7	A	G	3: 117,838,990		probably benign	Het
Sptbn2	A	G	19: 4,745,922	I1710V	probably damaging	Het
Sytl2	A	T	7: 90,376,081	I426F	probably benign	Het
Tdp1	A	G	12: 99,891,752		probably benign	Het
Tmem232	C	A	17: 65,382,633	D496Y	possibly damaging	Het
Tomm20l	C	T	12: 71,111,742	A58V	possibly damaging	Het
Ttc26	T	A	6: 38,403,524		probably null	Het
Ttn	T	C	2: 76,945,274	E1854G	unknown	Het
Ttn	A	G	2: 76,974,208	V240A	probably benign	Het
Vmn2r98	A	T	17: 19,080,625	T630S	probably benign	Het
Xrcc1	G	C	7: 24,566,908	A220P	probably benign	Het

Other mutations in Akap13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Akap13	APN	7	75725971	missense	probably damaging	0.99
IGL00332:Akap13	APN	7	75728919	missense	probably damaging	1.00
IGL00481:Akap13	APN	7	75723895	missense	probably damaging	1.00
IGL00590:Akap13	APN	7	75610669	missense	probably benign	0.01
IGL00655:Akap13	APN	7	75704398	missense	probably damaging	0.99
IGL00766:Akap13	APN	7	75704512	missense	probably damaging	0.96
IGL00818:Akap13	APN	7	75609727	missense	probably benign	0.00
IGL00826:Akap13	APN	7	75677447	missense	probably damaging	1.00
IGL01014:Akap13	APN	7	75750633	utr 3 prime	probably benign
IGL01090:Akap13	APN	7	75666531	missense	probably benign	0.44
IGL01155:Akap13	APN	7	75569936	missense	probably damaging	1.00
IGL01326:Akap13	APN	7	75725348	missense	probably benign	0.30
IGL01456:Akap13	APN	7	75602847	missense	probably damaging	0.98
IGL01460:Akap13	APN	7	75747846	missense	probably benign	0.29
IGL01568:Akap13	APN	7	75608522	nonsense	probably null	0.00
IGL01610:Akap13	APN	7	75720180	missense	possibly damaging	0.71
IGL01610:Akap13	APN	7	75747605	missense	probably damaging	1.00
IGL01615:Akap13	APN	7	75697393	missense	probably damaging	1.00
IGL01667:Akap13	APN	7	75570019	missense	probably damaging	1.00
IGL01705:Akap13	APN	7	75746767	missense	possibly damaging	0.86
IGL02070:Akap13	APN	7	75666545	missense	probably benign	0.27
IGL02269:Akap13	APN	7	75602911	missense	probably benign
IGL02421:Akap13	APN	7	75717806	missense	possibly damaging	0.66
IGL02870:Akap13	APN	7	75609188	missense	probably damaging	0.96
IGL02944:Akap13	APN	7	75608657	missense	probably benign
IGL03051:Akap13	APN	7	75610485	nonsense	probably null
IGL03160:Akap13	APN	7	75730417	missense	probably damaging	1.00
IGL03245:Akap13	APN	7	75609752	missense	probably damaging	0.99
R0254:Akap13	UTSW	7	75736604	splice site	probably benign
R0310:Akap13	UTSW	7	75614930	missense	probably damaging	0.99
R0373:Akap13	UTSW	7	75609929	missense	probably benign	0.00
R0373:Akap13	UTSW	7	75730500	missense	probably damaging	1.00
R0408:Akap13	UTSW	7	75746796	missense	probably damaging	1.00
R0631:Akap13	UTSW	7	75614996	missense	probably damaging	0.99
R0646:Akap13	UTSW	7	75747746	missense	probably damaging	1.00
R0781:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R0845:Akap13	UTSW	7	75725380	missense	probably damaging	1.00
R1004:Akap13	UTSW	7	75687286	missense	probably damaging	0.99
R1024:Akap13	UTSW	7	75677409	missense	probably damaging	1.00
R1110:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R1346:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1349:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1372:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1387:Akap13	UTSW	7	75586193	missense	probably damaging	0.97
R1442:Akap13	UTSW	7	75735778	missense	probably damaging	0.99
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1584:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1696:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1738:Akap13	UTSW	7	75677194	missense	probably damaging	1.00
R1773:Akap13	UTSW	7	75683451	missense	possibly damaging	0.80
R1785:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1786:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1791:Akap13	UTSW	7	75611035	missense	probably benign	0.00
R1819:Akap13	UTSW	7	75608705	missense	probably benign	0.04
R1879:Akap13	UTSW	7	75610727	missense	probably benign	0.01
R1989:Akap13	UTSW	7	75704516	missense	probably benign	0.01
R2016:Akap13	UTSW	7	75704531	missense	probably damaging	0.99
R2092:Akap13	UTSW	7	75610570	missense	probably benign	0.05
R2126:Akap13	UTSW	7	75725304	missense	possibly damaging	0.95
R2131:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2132:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2133:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2251:Akap13	UTSW	7	75739477	missense	possibly damaging	0.50
R3704:Akap13	UTSW	7	75666550	missense	probably damaging	1.00
R3713:Akap13	UTSW	7	75586181	missense	probably damaging	0.98
R3731:Akap13	UTSW	7	75611377	missense	probably benign	0.39
R3765:Akap13	UTSW	7	75608837	missense	probably benign	0.04
R3793:Akap13	UTSW	7	75610141	missense	probably benign	0.00
R3970:Akap13	UTSW	7	75569951	nonsense	probably null
R4205:Akap13	UTSW	7	75610919	missense	probably benign	0.05
R4257:Akap13	UTSW	7	75611285	missense	probably damaging	0.98
R4374:Akap13	UTSW	7	75608984	missense	probably damaging	0.96
R4448:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4450:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4457:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4458:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4466:Akap13	UTSW	7	75602773	splice site	probably null
R4632:Akap13	UTSW	7	75666553	missense	possibly damaging	0.91
R4667:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4669:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4671:Akap13	UTSW	7	75579564	nonsense	probably null
R4821:Akap13	UTSW	7	75677507	intron	probably benign
R4868:Akap13	UTSW	7	75743504	missense	probably damaging	1.00
R4894:Akap13	UTSW	7	75725320	missense	possibly damaging	0.76
R4943:Akap13	UTSW	7	75749240	missense	probably benign	0.22
R4962:Akap13	UTSW	7	75749430	missense	probably damaging	0.98
R4988:Akap13	UTSW	7	75730528	missense	probably damaging	1.00
R5119:Akap13	UTSW	7	75687252	missense	probably damaging	0.98
R5141:Akap13	UTSW	7	75609614	missense	probably benign	0.18
R5419:Akap13	UTSW	7	75610243	missense	probably benign	0.01
R5427:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R5429:Akap13	UTSW	7	75602904	missense	possibly damaging	0.70
R5432:Akap13	UTSW	7	75602830	missense	probably damaging	1.00
R5458:Akap13	UTSW	7	75586301	missense	probably damaging	1.00
R5636:Akap13	UTSW	7	75704372	missense	probably damaging	0.96
R5643:Akap13	UTSW	7	75702154	critical splice donor site	probably null
R5898:Akap13	UTSW	7	75729146	missense	probably damaging	1.00
R5932:Akap13	UTSW	7	75610184	missense	probably damaging	1.00
R6135:Akap13	UTSW	7	75609908	missense	possibly damaging	0.94
R6137:Akap13	UTSW	7	75677416	missense	probably damaging	1.00
R6182:Akap13	UTSW	7	75586280	missense	probably benign	0.45
R6310:Akap13	UTSW	7	75749193	missense	probably damaging	0.99
R6346:Akap13	UTSW	7	75685254	missense	probably damaging	1.00
R6466:Akap13	UTSW	7	75727044	missense	probably benign	0.01
R6605:Akap13	UTSW	7	75579768	missense	probably damaging	0.98
R6617:Akap13	UTSW	7	75730363	missense	possibly damaging	0.95
R6621:Akap13	UTSW	7	75569981	missense	probably damaging	1.00
R6703:Akap13	UTSW	7	75602898	missense	probably damaging	1.00
R6750:Akap13	UTSW	7	75739458	missense	probably benign	0.03
R7069:Akap13	UTSW	7	75610262	missense	probably benign	0.29
R7116:Akap13	UTSW	7	75720195	missense	probably benign	0.00
R7158:Akap13	UTSW	7	75579594	missense	probably damaging	0.97
R7159:Akap13	UTSW	7	75730579	missense	possibly damaging	0.72
R7467:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7468:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7471:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7472:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7477:Akap13	UTSW	7	75749247	missense	probably benign
R7636:Akap13	UTSW	7	75609873	missense	probably benign	0.04
R7650:Akap13	UTSW	7	75643454	missense	probably benign	0.20
R7671:Akap13	UTSW	7	75569900	missense	probably damaging	1.00
R7681:Akap13	UTSW	7	75728796	missense	possibly damaging	0.91
R7752:Akap13	UTSW	7	75677258	missense	possibly damaging	0.74
R7784:Akap13	UTSW	7	75610328	missense	probably benign	0.00
R7816:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7817:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7834:Akap13	UTSW	7	75742642	missense	possibly damaging	0.85
R7880:Akap13	UTSW	7	75586216	missense	probably damaging	0.97
R7942:Akap13	UTSW	7	75611470	missense	possibly damaging	0.50
R8006:Akap13	UTSW	7	75579696	missense	probably damaging	1.00
R8009:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8011:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8012:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8013:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8016:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8089:Akap13	UTSW	7	75610592	missense	possibly damaging	0.94
R8138:Akap13	UTSW	7	75702231	splice site	probably null
R8174:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R8298:Akap13	UTSW	7	75747804	missense	probably damaging	1.00
R8444:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8445:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8465:Akap13	UTSW	7	75727038	missense	probably benign	0.11
R8512:Akap13	UTSW	7	75611086	missense	probably damaging	0.99
R8523:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8793:Akap13	UTSW	7	75725328	missense	probably benign	0.35
R8907:Akap13	UTSW	7	75610696	missense	probably benign	0.08
R8907:Akap13	UTSW	7	75610708	missense	probably damaging	0.99
R8928:Akap13	UTSW	7	75609858	missense	probably benign	0.00
R8929:Akap13	UTSW	7	75609004	missense	probably benign	0.00
R8937:Akap13	UTSW	7	75534853	critical splice donor site	probably null
R8967:Akap13	UTSW	7	75729134	missense	possibly damaging	0.80
R8986:Akap13	UTSW	7	75609326	missense	probably benign
R9152:Akap13	UTSW	7	75611285	missense	probably damaging	0.98
R9153:Akap13	UTSW	7	75609481	missense	probably benign	0.00
R9160:Akap13	UTSW	7	75735778	missense	possibly damaging	0.88
R9192:Akap13	UTSW	7	75704501	missense	probably benign	0.06
R9319:Akap13	UTSW	7	75609088	missense	probably benign	0.01
R9513:Akap13	UTSW	7	75704527	missense	probably benign	0.01
R9515:Akap13	UTSW	7	75704527	missense	probably benign	0.01
R9516:Akap13	UTSW	7	75704527	missense	probably benign	0.01
R9523:Akap13	UTSW	7	75643445	missense
R9564:Akap13	UTSW	7	75609413	missense	probably benign
R9621:Akap13	UTSW	7	75736342	missense	probably benign	0.09
R9686:Akap13	UTSW	7	75586336	missense	probably damaging	1.00
Z1176:Akap13	UTSW	7	75730552	missense	probably damaging	0.99
Z1177:Akap13	UTSW	7	75615005	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TGTCTCAAGGAAGCAGGCAG -3'
(R):5'- AACTTTCTAGGCCAGCTAGGTGAG -3'

Sequencing Primer
(F):5'- GCAGGCAGCCTCAACCC -3'
(R):5'- GCCTCTGGCGAACTGTAATG -3'

Posted On

2015-03-25