Mutagenetix > Incidental Mutations

Incidental Mutation 'R3788:Olfr559'

272380

Institutional Source

Beutler Lab

Gene Symbol

Olfr559

Ensembl Gene

ENSMUSG00000066272

Gene Name

olfactory receptor 559

Synonyms

GA_x6K02T2PBJ9-5441154-5440198, MOR11-1

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R3788 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102723207-102727491 bp(-) (GRCm38)

Type of Mutation

splice site (2 bp from exon)

DNA Base Change (assembly)

A to G at 102723487 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000095820 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084816] [ENSMUST00000215657] [ENSMUST00000216312]

Predicted Effect

probably null
Transcript: ENSMUST00000084816

SMART Domains

Protein: ENSMUSP00000095820
Gene: ENSMUSG00000066272

Domain	Start	End	E-Value	Type
Pfam:7tm_4	37	317	1.1e-117	PFAM
Pfam:7TM_GPCR_Srsx	41	215	1e-10	PFAM
Pfam:7tm_1	47	299	3e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215657

Predicted Effect

probably benign
Transcript: ENSMUST00000216312

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,288,297		probably null	Het
Abca4	T	A	3: 122,052,912	V26E	possibly damaging	Het
Abhd16a	A	G	17: 35,101,587	N411S	probably damaging	Het
Akap13	G	A	7: 75,702,153		probably null	Het
Aph1b	T	C	9: 66,794,066		probably benign	Het
Aspm	C	T	1: 139,463,203	T742I	probably damaging	Het
Bclaf3	A	G	X: 159,566,496	H619R	probably benign	Het
Cemip	A	T	7: 83,943,898	L1199H	probably damaging	Het
Chd2	G	A	7: 73,447,130		probably benign	Het
Clnk	A	G	5: 38,714,998	Y310H	probably damaging	Het
Crmp1	A	G	5: 37,284,140	D522G	probably damaging	Het
Cyth3	A	G	5: 143,636,543		probably benign	Het
Dcbld1	T	A	10: 52,319,658	Y392N	probably damaging	Het
Fam60a	A	G	6: 148,926,119	S134P	possibly damaging	Het
Flnc	T	C	6: 29,454,057	F1820L	probably damaging	Het
Galnt18	G	A	7: 111,520,115	R385*	probably null	Het
Gpatch3	C	A	4: 133,575,168	R137S	possibly damaging	Het
Gpc6	C	T	14: 117,624,466	P265S	probably damaging	Het
Harbi1	T	A	2: 91,720,607	D308E	probably benign	Het
Hdhd2	G	A	18: 76,955,187		probably null	Het
Hk1	T	C	10: 62,275,688	K737E	possibly damaging	Het
Hnrnpr	G	A	4: 136,336,313	V345M	probably damaging	Het
Kalrn	T	C	16: 34,220,240	H944R	probably damaging	Het
Kdm2a	A	T	19: 4,351,805	C207S	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt75	C	T	15: 101,573,521	G104D	possibly damaging	Het
Lnpk	A	T	2: 74,522,263	S358R	probably benign	Het
Map2	A	G	1: 66,416,863	T1512A	probably damaging	Het
March10	T	A	11: 105,397,079	L132F	probably damaging	Het
Mfrp	G	A	9: 44,105,457	W65*	probably null	Het
Mgat5	A	G	1: 127,366,443	D174G	probably benign	Het
Miga2	T	A	2: 30,371,225	Y177*	probably null	Het
Mroh3	T	C	1: 136,185,475	D747G	probably damaging	Het
Muc5b	A	G	7: 141,863,834	T3506A	possibly damaging	Het
Myo7b	G	T	18: 31,974,112	P1277T	possibly damaging	Het
Naaa	C	T	5: 92,272,554		probably null	Het
Ndufs2	T	C	1: 171,235,320	D410G	possibly damaging	Het
Olfr506	T	A	7: 108,613,073	Y255*	probably null	Het
Olfr873	A	G	9: 20,300,370	I58V	probably benign	Het
Olfr955	A	G	9: 39,470,069	I219T	probably benign	Het
Osbp	A	T	19: 11,978,921	Y409F	probably benign	Het
Plxnb1	T	A	9: 109,109,287	V1303D	possibly damaging	Het
Prkcg	G	A	7: 3,313,747	D246N	probably damaging	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,219,203		probably benign	Het
Sbf1	G	A	15: 89,299,528	R1261*	probably null	Het
Scn4a	T	C	11: 106,344,274	N341S	probably damaging	Het
Sec61a2	C	A	2: 5,879,625		probably null	Het
Sgcd	T	A	11: 47,355,205	K57*	probably null	Het
Slc12a5	T	C	2: 164,993,775	L861P	probably damaging	Het
Slc6a16	A	G	7: 45,259,962	D184G	probably benign	Het
Snx7	A	G	3: 117,838,990		probably benign	Het
Sptbn2	A	G	19: 4,745,922	I1710V	probably damaging	Het
Sytl2	A	T	7: 90,376,081	I426F	probably benign	Het
Tdp1	A	G	12: 99,891,752		probably benign	Het
Tmem232	C	A	17: 65,382,633	D496Y	possibly damaging	Het
Tomm20l	C	T	12: 71,111,742	A58V	possibly damaging	Het
Ttc26	T	A	6: 38,403,524		probably null	Het
Ttn	T	C	2: 76,945,274	E1854G	unknown	Het
Ttn	A	G	2: 76,974,208	V240A	probably benign	Het
Vmn2r98	A	T	17: 19,080,625	T630S	probably benign	Het
Xrcc1	G	C	7: 24,566,908	A220P	probably benign	Het

Other mutations in Olfr559

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02832:Olfr559	APN	7	102723651	missense	probably benign	0.01
R0505:Olfr559	UTSW	7	102724029	missense	probably damaging	0.97
R1131:Olfr559	UTSW	7	102723680	missense	probably damaging	0.99
R1449:Olfr559	UTSW	7	102724190	missense	probably damaging	1.00
R3915:Olfr559	UTSW	7	102724202	missense	possibly damaging	0.95
R3980:Olfr559	UTSW	7	102723752	missense	probably damaging	0.98
R4647:Olfr559	UTSW	7	102724092	missense	probably damaging	1.00
R5242:Olfr559	UTSW	7	102724276	missense	probably benign	0.41
R5404:Olfr559	UTSW	7	102723600	missense	possibly damaging	0.95
R5464:Olfr559	UTSW	7	102723917	missense	possibly damaging	0.85
R5807:Olfr559	UTSW	7	102724202	missense	possibly damaging	0.95
R5965:Olfr559	UTSW	7	102724260	missense	probably benign	0.00
R6008:Olfr559	UTSW	7	102724367	missense	probably damaging	1.00
R6036:Olfr559	UTSW	7	102724485	missense	probably benign
R6036:Olfr559	UTSW	7	102724485	missense	probably benign
R6493:Olfr559	UTSW	7	102724080	missense	possibly damaging	0.85
R6756:Olfr559	UTSW	7	102724088	missense	probably benign	0.03
R7201:Olfr559	UTSW	7	102724485	missense	probably benign
R7460:Olfr559	UTSW	7	102723821	missense	probably benign	0.09
R7695:Olfr559	UTSW	7	102723659	missense	probably benign	0.37
R8145:Olfr559	UTSW	7	102723730	missense	probably damaging	0.98
R8371:Olfr559	UTSW	7	102723583	missense	probably damaging	1.00
R8499:Olfr559	UTSW	7	102723725	missense	probably damaging	1.00
X0025:Olfr559	UTSW	7	102723815	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCAGGAAACATTGGCTTTAAG -3'
(R):5'- AAAGCACCTGCCTCACATTG -3'

Sequencing Primer
(F):5'- TTCAGGTCAGAGAATGTAGCTC -3'
(R):5'- ACATTGTTCATGCCCTGGTTG -3'

Posted On

2015-03-25