Incidental Mutation 'R3788:Mfrp'
ID272387
Institutional Source Beutler Lab
Gene Symbol Mfrp
Ensembl Gene ENSMUSG00000034739
Gene Namemembrane frizzled-related protein
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R3788 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44101729-44109187 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 44105457 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 65 (W65*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034654] [ENSMUST00000065379] [ENSMUST00000114815] [ENSMUST00000114816] [ENSMUST00000114818] [ENSMUST00000114821] [ENSMUST00000152956] [ENSMUST00000161381] [ENSMUST00000161703] [ENSMUST00000162126] [ENSMUST00000206308] [ENSMUST00000206295] [ENSMUST00000205282] [ENSMUST00000205500] [ENSMUST00000206769] [ENSMUST00000185479]
Predicted Effect probably null
Transcript: ENSMUST00000034654
AA Change: W448*
SMART Domains Protein: ENSMUSP00000034654
Gene: ENSMUSG00000034739
AA Change: W448*

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
CUB 307 420 1.85e-37 SMART
Pfam:Fz 471 577 3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065379
SMART Domains Protein: ENSMUSP00000070060
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114815
SMART Domains Protein: ENSMUSP00000110463
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114816
SMART Domains Protein: ENSMUSP00000110464
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114818
SMART Domains Protein: ENSMUSP00000110466
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114821
SMART Domains Protein: ENSMUSP00000110469
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 220 1.01e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152956
SMART Domains Protein: ENSMUSP00000123040
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Collagen 28 102 7.2e-10 PFAM
Pfam:C1q 105 138 1.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160985
SMART Domains Protein: ENSMUSP00000124568
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
RING 11 52 1.57e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161381
AA Change: W442*
SMART Domains Protein: ENSMUSP00000124456
Gene: ENSMUSG00000034739
AA Change: W442*

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
CUB 307 420 1.85e-37 SMART
Pfam:Fz 465 576 9.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161703
SMART Domains Protein: ENSMUSP00000125053
Gene: ENSMUSG00000034739

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
LDLa 307 342 2.09e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162126
SMART Domains Protein: ENSMUSP00000123938
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162196
Predicted Effect probably null
Transcript: ENSMUST00000206722
AA Change: W65*
Predicted Effect probably null
Transcript: ENSMUST00000206308
AA Change: W448*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174014
Predicted Effect probably benign
Transcript: ENSMUST00000206295
Predicted Effect probably benign
Transcript: ENSMUST00000205282
Predicted Effect probably benign
Transcript: ENSMUST00000205500
Predicted Effect probably benign
Transcript: ENSMUST00000206769
Predicted Effect probably benign
Transcript: ENSMUST00000185479
SMART Domains Protein: ENSMUSP00000140405
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Meta Mutation Damage Score 0.9710 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: The protein encoded by this gene contains a region with similarity to the cysteine-rich domain (CRD) of frizzled, a gene originally found in Drosophila that controls tissue polarity. This protein functions in eye development, where it is necessary for the maintenance of photoreceptor outer segments. Mutations in this gene cause retinal degeneration 6 in mice, which gives rise to a mouse model for human retinitis punctata albescens. Bicistronic transcripts composed of the coding sequences for this gene (Mfrp) and the C1q and tumor necrosis factor related protein 5 gene (C1qtnf5) have been identified, and the resulting products can interact with each other. Co-transcription of C1qtnf5 and Mfrp has been observed in both human and mouse. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mutations produce mice having small, white retinal spots and progressive photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,288,297 probably null Het
Abca4 T A 3: 122,052,912 V26E possibly damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Akap13 G A 7: 75,702,153 probably null Het
Aph1b T C 9: 66,794,066 probably benign Het
Aspm C T 1: 139,463,203 T742I probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Cemip A T 7: 83,943,898 L1199H probably damaging Het
Chd2 G A 7: 73,447,130 probably benign Het
Clnk A G 5: 38,714,998 Y310H probably damaging Het
Crmp1 A G 5: 37,284,140 D522G probably damaging Het
Cyth3 A G 5: 143,636,543 probably benign Het
Dcbld1 T A 10: 52,319,658 Y392N probably damaging Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Flnc T C 6: 29,454,057 F1820L probably damaging Het
Galnt18 G A 7: 111,520,115 R385* probably null Het
Gpatch3 C A 4: 133,575,168 R137S possibly damaging Het
Gpc6 C T 14: 117,624,466 P265S probably damaging Het
Harbi1 T A 2: 91,720,607 D308E probably benign Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hk1 T C 10: 62,275,688 K737E possibly damaging Het
Hnrnpr G A 4: 136,336,313 V345M probably damaging Het
Kalrn T C 16: 34,220,240 H944R probably damaging Het
Kdm2a A T 19: 4,351,805 C207S probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt75 C T 15: 101,573,521 G104D possibly damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
March10 T A 11: 105,397,079 L132F probably damaging Het
Mgat5 A G 1: 127,366,443 D174G probably benign Het
Miga2 T A 2: 30,371,225 Y177* probably null Het
Mroh3 T C 1: 136,185,475 D747G probably damaging Het
Muc5b A G 7: 141,863,834 T3506A possibly damaging Het
Myo7b G T 18: 31,974,112 P1277T possibly damaging Het
Naaa C T 5: 92,272,554 probably null Het
Ndufs2 T C 1: 171,235,320 D410G possibly damaging Het
Olfr506 T A 7: 108,613,073 Y255* probably null Het
Olfr559 A G 7: 102,723,487 probably null Het
Olfr873 A G 9: 20,300,370 I58V probably benign Het
Olfr955 A G 9: 39,470,069 I219T probably benign Het
Osbp A T 19: 11,978,921 Y409F probably benign Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Prkcg G A 7: 3,313,747 D246N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sbf1 G A 15: 89,299,528 R1261* probably null Het
Scn4a T C 11: 106,344,274 N341S probably damaging Het
Sec61a2 C A 2: 5,879,625 probably null Het
Sgcd T A 11: 47,355,205 K57* probably null Het
Slc12a5 T C 2: 164,993,775 L861P probably damaging Het
Slc6a16 A G 7: 45,259,962 D184G probably benign Het
Snx7 A G 3: 117,838,990 probably benign Het
Sptbn2 A G 19: 4,745,922 I1710V probably damaging Het
Sytl2 A T 7: 90,376,081 I426F probably benign Het
Tdp1 A G 12: 99,891,752 probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttc26 T A 6: 38,403,524 probably null Het
Ttn T C 2: 76,945,274 E1854G unknown Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r98 A T 17: 19,080,625 T630S probably benign Het
Xrcc1 G C 7: 24,566,908 A220P probably benign Het
Other mutations in Mfrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02070:Mfrp APN 9 44104689 missense probably benign 0.39
IGL02077:Mfrp APN 9 44105220 missense probably damaging 1.00
IGL02313:Mfrp APN 9 44102874 missense probably damaging 1.00
IGL02544:Mfrp APN 9 44102794 missense probably damaging 1.00
IGL02709:Mfrp APN 9 44103264 missense probably benign 0.00
R1592:Mfrp UTSW 9 44103222 missense probably damaging 1.00
R1728:Mfrp UTSW 9 44104587 missense possibly damaging 0.73
R1729:Mfrp UTSW 9 44104587 missense possibly damaging 0.73
R1886:Mfrp UTSW 9 44103488 missense possibly damaging 0.94
R1974:Mfrp UTSW 9 44106372 missense probably damaging 1.00
R2146:Mfrp UTSW 9 44103718 missense probably benign 0.12
R2150:Mfrp UTSW 9 44103718 missense probably benign 0.12
R2512:Mfrp UTSW 9 44102538 missense probably benign 0.01
R4204:Mfrp UTSW 9 44105228 missense possibly damaging 0.86
R4240:Mfrp UTSW 9 44102866 missense possibly damaging 0.91
R4839:Mfrp UTSW 9 44102135 missense possibly damaging 0.89
R4963:Mfrp UTSW 9 44103264 missense probably benign 0.33
R5041:Mfrp UTSW 9 44102278 missense probably damaging 1.00
R6370:Mfrp UTSW 9 44106261 missense probably damaging 1.00
R7420:Mfrp UTSW 9 44102476 unclassified probably benign
R7454:Mfrp UTSW 9 44105183 missense possibly damaging 0.90
R8750:Mfrp UTSW 9 44103505 missense probably benign 0.05
R8850:Mfrp UTSW 9 44102510 missense probably benign 0.10
Z1177:Mfrp UTSW 9 44102519 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAATACTACAGAGAGTGGGTGTCC -3'
(R):5'- GAGTGTACAATGCCACCACC -3'

Sequencing Primer
(F):5'- AGAGAGTGGGTGTCCCTGGG -3'
(R):5'- CACCAGCTGAGAGTCCTTGAAG -3'
Posted On2015-03-25