Incidental Mutation 'R3788:Sgcd'
ID272394
Institutional Source Beutler Lab
Gene Symbol Sgcd
Ensembl Gene ENSMUSG00000020354
Gene Namesarcoglycan, delta (dystrophin-associated glycoprotein)
Synonymsdelta-SG
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R3788 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location46896253-47988969 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 47355205 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 57 (K57*)
Ref Sequence ENSEMBL: ENSMUSP00000104843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077221] [ENSMUST00000109220]
Predicted Effect probably null
Transcript: ENSMUST00000077221
AA Change: K57*
SMART Domains Protein: ENSMUSP00000076459
Gene: ENSMUSG00000020354
AA Change: K57*

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 23 278 3.2e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109220
AA Change: K57*
SMART Domains Protein: ENSMUSP00000104843
Gene: ENSMUSG00000020354
AA Change: K57*

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 21 192 2.4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154578
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display cardiomyopathy and muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,288,297 probably null Het
Abca4 T A 3: 122,052,912 V26E possibly damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Akap13 G A 7: 75,702,153 probably null Het
Aph1b T C 9: 66,794,066 probably benign Het
Aspm C T 1: 139,463,203 T742I probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Cemip A T 7: 83,943,898 L1199H probably damaging Het
Chd2 G A 7: 73,447,130 probably benign Het
Clnk A G 5: 38,714,998 Y310H probably damaging Het
Crmp1 A G 5: 37,284,140 D522G probably damaging Het
Cyth3 A G 5: 143,636,543 probably benign Het
Dcbld1 T A 10: 52,319,658 Y392N probably damaging Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Flnc T C 6: 29,454,057 F1820L probably damaging Het
Galnt18 G A 7: 111,520,115 R385* probably null Het
Gpatch3 C A 4: 133,575,168 R137S possibly damaging Het
Gpc6 C T 14: 117,624,466 P265S probably damaging Het
Harbi1 T A 2: 91,720,607 D308E probably benign Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hk1 T C 10: 62,275,688 K737E possibly damaging Het
Hnrnpr G A 4: 136,336,313 V345M probably damaging Het
Kalrn T C 16: 34,220,240 H944R probably damaging Het
Kdm2a A T 19: 4,351,805 C207S probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt75 C T 15: 101,573,521 G104D possibly damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
March10 T A 11: 105,397,079 L132F probably damaging Het
Mfrp G A 9: 44,105,457 W65* probably null Het
Mgat5 A G 1: 127,366,443 D174G probably benign Het
Miga2 T A 2: 30,371,225 Y177* probably null Het
Mroh3 T C 1: 136,185,475 D747G probably damaging Het
Muc5b A G 7: 141,863,834 T3506A possibly damaging Het
Myo7b G T 18: 31,974,112 P1277T possibly damaging Het
Naaa C T 5: 92,272,554 probably null Het
Ndufs2 T C 1: 171,235,320 D410G possibly damaging Het
Olfr506 T A 7: 108,613,073 Y255* probably null Het
Olfr559 A G 7: 102,723,487 probably null Het
Olfr873 A G 9: 20,300,370 I58V probably benign Het
Olfr955 A G 9: 39,470,069 I219T probably benign Het
Osbp A T 19: 11,978,921 Y409F probably benign Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Prkcg G A 7: 3,313,747 D246N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sbf1 G A 15: 89,299,528 R1261* probably null Het
Scn4a T C 11: 106,344,274 N341S probably damaging Het
Sec61a2 C A 2: 5,879,625 probably null Het
Slc12a5 T C 2: 164,993,775 L861P probably damaging Het
Slc6a16 A G 7: 45,259,962 D184G probably benign Het
Snx7 A G 3: 117,838,990 probably benign Het
Sptbn2 A G 19: 4,745,922 I1710V probably damaging Het
Sytl2 A T 7: 90,376,081 I426F probably benign Het
Tdp1 A G 12: 99,891,752 probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttc26 T A 6: 38,403,524 probably null Het
Ttn T C 2: 76,945,274 E1854G unknown Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r98 A T 17: 19,080,625 T630S probably benign Het
Xrcc1 G C 7: 24,566,908 A220P probably benign Het
Other mutations in Sgcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01763:Sgcd APN 11 47195029 critical splice donor site probably null
IGL02013:Sgcd APN 11 46980943 intron probably benign
IGL02447:Sgcd APN 11 46979255 intron probably benign
R1682:Sgcd UTSW 11 47195042 missense probably benign
R1879:Sgcd UTSW 11 47355241 missense probably benign 0.25
R1894:Sgcd UTSW 11 47195110 missense probably damaging 1.00
R2238:Sgcd UTSW 11 47132682 missense possibly damaging 0.50
R4948:Sgcd UTSW 11 46979435 missense possibly damaging 0.92
R5179:Sgcd UTSW 11 46980884 missense probably benign 0.33
R5894:Sgcd UTSW 11 47355201 missense probably damaging 1.00
R7081:Sgcd UTSW 11 47125601 nonsense probably null
R7579:Sgcd UTSW 11 47125654 missense possibly damaging 0.77
X0066:Sgcd UTSW 11 47355373 start codon destroyed possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGGGCCATTATGATGATGGAGC -3'
(R):5'- AATGTGAGTGGTTCTCTGTACC -3'

Sequencing Primer
(F):5'- TGGAGCGAAGACCTATATATTAGAC -3'
(R):5'- GAGTGGTTCTCTGTACCTGCTTC -3'
Posted On2015-03-25