Mutagenetix > Incidental Mutations

Incidental Mutation 'R3788:Sbf1'

272402

Institutional Source

Beutler Lab

Gene Symbol

Sbf1

Ensembl Gene

ENSMUSG00000036529

Gene Name

SET binding factor 1

Synonyms

B230113C15Rik, 2610510A08Rik, Mtmr5

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.442) question?

Stock #

R3788 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89288236-89315311 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 89299528 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 1261 (R1261*)

Ref Sequence

ENSEMBL: ENSMUSP00000118107 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123791] [ENSMUST00000124576] [ENSMUST00000144585]

PDB Structure

Solution Structure of the C-terminal Pleckstrin Homology Domain of Sbf1 from Mouse [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000123791
AA Change: R1261*

SMART Domains

Protein: ENSMUSP00000120725
Gene: ENSMUSG00000036529
AA Change: R1261*

Domain	Start	End	E-Value	Type
uDENN	1	86	6.68e-31	SMART
DENN	128	310	4.05e-71	SMART
dDENN	363	432	1.28e-18	SMART
Pfam:SBF2	540	764	4.1e-110	PFAM
GRAM	882	968	3.93e-12	SMART
Pfam:Myotub-related	1100	1534	6.2e-114	PFAM
low complexity region	1614	1621	N/A	INTRINSIC
low complexity region	1652	1666	N/A	INTRINSIC
low complexity region	1719	1750	N/A	INTRINSIC
PH	1762	1867	6.45e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124398

Predicted Effect

probably benign
Transcript: ENSMUST00000124576

SMART Domains

Protein: ENSMUSP00000115740
Gene: ENSMUSG00000036529

Domain	Start	End	E-Value	Type
uDENN	1	86	6.68e-31	SMART
DENN	128	310	4.05e-71	SMART
Pfam:dDENN	363	403	4.6e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124642

SMART Domains

Protein: ENSMUSP00000119943
Gene: ENSMUSG00000036529

Domain	Start	End	E-Value	Type
Pfam:SBF2	1	94	1.2e-36	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000144585
AA Change: R1261*

SMART Domains

Protein: ENSMUSP00000118107
Gene: ENSMUSG00000036529
AA Change: R1261*

Domain	Start	End	E-Value	Type
uDENN	1	86	6.68e-31	SMART
DENN	128	310	4.05e-71	SMART
dDENN	363	432	1.28e-18	SMART
Pfam:SBF2	542	764	2.3e-108	PFAM
GRAM	882	968	3.93e-12	SMART
Pfam:Myotub-related	1106	1558	5.7e-93	PFAM
low complexity region	1640	1647	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
low complexity region	1745	1776	N/A	INTRINSIC
PH	1788	1893	6.45e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150539

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155146

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176028

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. However, the encoded protein does not appear to be a catalytically active phosphatase because it lacks several amino acids in the catalytic pocket. This protein contains a Guanine nucleotide exchange factor (GEF) domain which is necessary for its role in growth and differentiation. Mutations in this gene have been associated with Charcot-Marie-Tooth disease 4B3. Pseudogenes of this gene have been defined on chromosomes 1 and 8. [provided by RefSeq, Dec 2014]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit male infertility associated with azoospermia, vacuolation of Sertoli cells, reduced spermatid formation, and eventual depletion of germ cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,288,297		probably null	Het
Abca4	T	A	3: 122,052,912	V26E	possibly damaging	Het
Abhd16a	A	G	17: 35,101,587	N411S	probably damaging	Het
Akap13	G	A	7: 75,702,153		probably null	Het
Aph1b	T	C	9: 66,794,066		probably benign	Het
Aspm	C	T	1: 139,463,203	T742I	probably damaging	Het
Bclaf3	A	G	X: 159,566,496	H619R	probably benign	Het
Cemip	A	T	7: 83,943,898	L1199H	probably damaging	Het
Chd2	G	A	7: 73,447,130		probably benign	Het
Clnk	A	G	5: 38,714,998	Y310H	probably damaging	Het
Crmp1	A	G	5: 37,284,140	D522G	probably damaging	Het
Cyth3	A	G	5: 143,636,543		probably benign	Het
Dcbld1	T	A	10: 52,319,658	Y392N	probably damaging	Het
Fam60a	A	G	6: 148,926,119	S134P	possibly damaging	Het
Flnc	T	C	6: 29,454,057	F1820L	probably damaging	Het
Galnt18	G	A	7: 111,520,115	R385*	probably null	Het
Gpatch3	C	A	4: 133,575,168	R137S	possibly damaging	Het
Gpc6	C	T	14: 117,624,466	P265S	probably damaging	Het
Harbi1	T	A	2: 91,720,607	D308E	probably benign	Het
Hdhd2	G	A	18: 76,955,187		probably null	Het
Hk1	T	C	10: 62,275,688	K737E	possibly damaging	Het
Hnrnpr	G	A	4: 136,336,313	V345M	probably damaging	Het
Kalrn	T	C	16: 34,220,240	H944R	probably damaging	Het
Kdm2a	A	T	19: 4,351,805	C207S	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt75	C	T	15: 101,573,521	G104D	possibly damaging	Het
Lnpk	A	T	2: 74,522,263	S358R	probably benign	Het
Map2	A	G	1: 66,416,863	T1512A	probably damaging	Het
March10	T	A	11: 105,397,079	L132F	probably damaging	Het
Mfrp	G	A	9: 44,105,457	W65*	probably null	Het
Mgat5	A	G	1: 127,366,443	D174G	probably benign	Het
Miga2	T	A	2: 30,371,225	Y177*	probably null	Het
Mroh3	T	C	1: 136,185,475	D747G	probably damaging	Het
Muc5b	A	G	7: 141,863,834	T3506A	possibly damaging	Het
Myo7b	G	T	18: 31,974,112	P1277T	possibly damaging	Het
Naaa	C	T	5: 92,272,554		probably null	Het
Ndufs2	T	C	1: 171,235,320	D410G	possibly damaging	Het
Olfr506	T	A	7: 108,613,073	Y255*	probably null	Het
Olfr559	A	G	7: 102,723,487		probably null	Het
Olfr873	A	G	9: 20,300,370	I58V	probably benign	Het
Olfr955	A	G	9: 39,470,069	I219T	probably benign	Het
Osbp	A	T	19: 11,978,921	Y409F	probably benign	Het
Plxnb1	T	A	9: 109,109,287	V1303D	possibly damaging	Het
Prkcg	G	A	7: 3,313,747	D246N	probably damaging	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,219,203		probably benign	Het
Scn4a	T	C	11: 106,344,274	N341S	probably damaging	Het
Sec61a2	C	A	2: 5,879,625		probably null	Het
Sgcd	T	A	11: 47,355,205	K57*	probably null	Het
Slc12a5	T	C	2: 164,993,775	L861P	probably damaging	Het
Slc6a16	A	G	7: 45,259,962	D184G	probably benign	Het
Snx7	A	G	3: 117,838,990		probably benign	Het
Sptbn2	A	G	19: 4,745,922	I1710V	probably damaging	Het
Sytl2	A	T	7: 90,376,081	I426F	probably benign	Het
Tdp1	A	G	12: 99,891,752		probably benign	Het
Tmem232	C	A	17: 65,382,633	D496Y	possibly damaging	Het
Tomm20l	C	T	12: 71,111,742	A58V	possibly damaging	Het
Ttc26	T	A	6: 38,403,524		probably null	Het
Ttn	T	C	2: 76,945,274	E1854G	unknown	Het
Ttn	A	G	2: 76,974,208	V240A	probably benign	Het
Vmn2r98	A	T	17: 19,080,625	T630S	probably benign	Het
Xrcc1	G	C	7: 24,566,908	A220P	probably benign	Het

Other mutations in Sbf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00265:Sbf1	APN	15	89305575	missense	probably damaging	0.98
IGL01478:Sbf1	APN	15	89299743	missense	probably damaging	0.97
IGL01533:Sbf1	APN	15	89288716	missense	probably damaging	0.99
IGL01603:Sbf1	APN	15	89303278	missense	probably damaging	1.00
IGL01758:Sbf1	APN	15	89303215	unclassified	probably benign
IGL01908:Sbf1	APN	15	89302726	missense	probably damaging	1.00
IGL02067:Sbf1	APN	15	89289044	missense	probably damaging	1.00
IGL02089:Sbf1	APN	15	89302505	nonsense	probably null
IGL02150:Sbf1	APN	15	89295480	missense	probably benign	0.00
IGL02284:Sbf1	APN	15	89305078	missense	probably damaging	1.00
IGL02367:Sbf1	APN	15	89307572	missense	probably damaging	0.99
IGL02427:Sbf1	APN	15	89305985	unclassified	probably benign
IGL03025:Sbf1	APN	15	89289645	missense	probably damaging	1.00
IGL03103:Sbf1	APN	15	89293947	missense	probably damaging	1.00
IGL03226:Sbf1	APN	15	89289105	missense	possibly damaging	0.93
IGL03376:Sbf1	APN	15	89289016	unclassified	probably benign
IGL03397:Sbf1	APN	15	89288721	missense	probably damaging	1.00
R0043:Sbf1	UTSW	15	89295561	missense	probably benign	0.26
R0139:Sbf1	UTSW	15	89302498	missense	probably damaging	1.00
R0528:Sbf1	UTSW	15	89288712	missense	probably damaging	0.99
R0624:Sbf1	UTSW	15	89302329	missense	possibly damaging	0.68
R0759:Sbf1	UTSW	15	89304716	missense	probably damaging	1.00
R1555:Sbf1	UTSW	15	89305076	missense	probably damaging	1.00
R1763:Sbf1	UTSW	15	89294425	missense	probably damaging	1.00
R2025:Sbf1	UTSW	15	89302730	missense	probably damaging	1.00
R2207:Sbf1	UTSW	15	89306693	missense	possibly damaging	0.88
R2844:Sbf1	UTSW	15	89303218	critical splice donor site	probably null
R2845:Sbf1	UTSW	15	89303218	critical splice donor site	probably null
R4108:Sbf1	UTSW	15	89288585	unclassified	probably benign
R4403:Sbf1	UTSW	15	89293954	missense	possibly damaging	0.94
R4605:Sbf1	UTSW	15	89303481	missense	probably damaging	1.00
R4620:Sbf1	UTSW	15	89306926	missense	probably damaging	0.99
R4666:Sbf1	UTSW	15	89295246	missense	probably damaging	1.00
R4696:Sbf1	UTSW	15	89303112	nonsense	probably null
R4697:Sbf1	UTSW	15	89315085	missense	possibly damaging	0.71
R4747:Sbf1	UTSW	15	89302713	missense	probably damaging	1.00
R5828:Sbf1	UTSW	15	89288634	missense	probably damaging	1.00
R5841:Sbf1	UTSW	15	89308068	missense	probably damaging	1.00
R6185:Sbf1	UTSW	15	89305611	missense	probably damaging	1.00
R6237:Sbf1	UTSW	15	89293476	missense	probably benign	0.29
R6256:Sbf1	UTSW	15	89300867	missense	probably benign	0.06
R6490:Sbf1	UTSW	15	89304908	missense	probably benign
R6933:Sbf1	UTSW	15	89300369	missense	probably damaging	1.00
R7806:Sbf1	UTSW	15	89305420	missense	possibly damaging	0.52
R7921:Sbf1	UTSW	15	89306223	missense	probably damaging	0.96
R8005:Sbf1	UTSW	15	89294205	missense	probably damaging	0.98
R8350:Sbf1	UTSW	15	89299509	missense	probably damaging	0.99
R8450:Sbf1	UTSW	15	89299509	missense	probably damaging	0.99
R8509:Sbf1	UTSW	15	89293457	missense	probably damaging	1.00
R8753:Sbf1	UTSW	15	89295459	missense	probably benign
R8788:Sbf1	UTSW	15	89301859	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTGGTCTGAGCAGTGTTC -3'
(R):5'- GGCCCAGAATACACCTTCTC -3'

Sequencing Primer
(F):5'- TGTCCCAGAACTCGGGAG -3'
(R):5'- CTCCAGGTACTCCTCCTCTG -3'

Posted On

2015-03-25