Incidental Mutation 'R3788:Abhd16a'
ID272406
Institutional Source Beutler Lab
Gene Symbol Abhd16a
Ensembl Gene ENSMUSG00000007036
Gene Nameabhydrolase domain containing 16A
SynonymsD17H6S82E, Bat5, NG26
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R3788 (G1)
Quality Score190
Status Validated
Chromosome17
Chromosomal Location35089263-35102987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35101587 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 411 (N411S)
Ref Sequence ENSEMBL: ENSMUSP00000007251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007251] [ENSMUST00000173846]
Predicted Effect probably damaging
Transcript: ENSMUST00000007251
AA Change: N411S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000007251
Gene: ENSMUSG00000007036
AA Change: N411S

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
low complexity region 165 179 N/A INTRINSIC
Pfam:Abhydrolase_1 280 415 6.3e-10 PFAM
Pfam:Abhydrolase_5 282 465 4.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172584
SMART Domains Protein: ENSMUSP00000133610
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
SCOP:d1imja_ 33 101 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173247
SMART Domains Protein: ENSMUSP00000134231
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
Pfam:Abhydrolase_6 2 115 8.6e-6 PFAM
Pfam:Abhydrolase_5 3 123 3.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173579
Predicted Effect probably benign
Transcript: ENSMUST00000173846
SMART Domains Protein: ENSMUSP00000133505
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
Meta Mutation Damage Score 0.1046 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for tumor necrosis factor alpha and tumor necrosis factor beta. These genes are all within the human major histocompatibility complex class III region. The protein encoded by this gene is thought to be involved in some aspects of immunity. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, decreased body size and weight, and decreased brain lysophosphatidylserines. Macrophages display a reduction in lysophosphatidylserines and LPS-induced cytokine production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,288,297 probably null Het
Abca4 T A 3: 122,052,912 V26E possibly damaging Het
Akap13 G A 7: 75,702,153 probably null Het
Aph1b T C 9: 66,794,066 probably benign Het
Aspm C T 1: 139,463,203 T742I probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Cemip A T 7: 83,943,898 L1199H probably damaging Het
Chd2 G A 7: 73,447,130 probably benign Het
Clnk A G 5: 38,714,998 Y310H probably damaging Het
Crmp1 A G 5: 37,284,140 D522G probably damaging Het
Cyth3 A G 5: 143,636,543 probably benign Het
Dcbld1 T A 10: 52,319,658 Y392N probably damaging Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Flnc T C 6: 29,454,057 F1820L probably damaging Het
Galnt18 G A 7: 111,520,115 R385* probably null Het
Gpatch3 C A 4: 133,575,168 R137S possibly damaging Het
Gpc6 C T 14: 117,624,466 P265S probably damaging Het
Harbi1 T A 2: 91,720,607 D308E probably benign Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hk1 T C 10: 62,275,688 K737E possibly damaging Het
Hnrnpr G A 4: 136,336,313 V345M probably damaging Het
Kalrn T C 16: 34,220,240 H944R probably damaging Het
Kdm2a A T 19: 4,351,805 C207S probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt75 C T 15: 101,573,521 G104D possibly damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
March10 T A 11: 105,397,079 L132F probably damaging Het
Mfrp G A 9: 44,105,457 W65* probably null Het
Mgat5 A G 1: 127,366,443 D174G probably benign Het
Miga2 T A 2: 30,371,225 Y177* probably null Het
Mroh3 T C 1: 136,185,475 D747G probably damaging Het
Muc5b A G 7: 141,863,834 T3506A possibly damaging Het
Myo7b G T 18: 31,974,112 P1277T possibly damaging Het
Naaa C T 5: 92,272,554 probably null Het
Ndufs2 T C 1: 171,235,320 D410G possibly damaging Het
Olfr506 T A 7: 108,613,073 Y255* probably null Het
Olfr559 A G 7: 102,723,487 probably null Het
Olfr873 A G 9: 20,300,370 I58V probably benign Het
Olfr955 A G 9: 39,470,069 I219T probably benign Het
Osbp A T 19: 11,978,921 Y409F probably benign Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Prkcg G A 7: 3,313,747 D246N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sbf1 G A 15: 89,299,528 R1261* probably null Het
Scn4a T C 11: 106,344,274 N341S probably damaging Het
Sec61a2 C A 2: 5,879,625 probably null Het
Sgcd T A 11: 47,355,205 K57* probably null Het
Slc12a5 T C 2: 164,993,775 L861P probably damaging Het
Slc6a16 A G 7: 45,259,962 D184G probably benign Het
Snx7 A G 3: 117,838,990 probably benign Het
Sptbn2 A G 19: 4,745,922 I1710V probably damaging Het
Sytl2 A T 7: 90,376,081 I426F probably benign Het
Tdp1 A G 12: 99,891,752 probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttc26 T A 6: 38,403,524 probably null Het
Ttn T C 2: 76,945,274 E1854G unknown Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r98 A T 17: 19,080,625 T630S probably benign Het
Xrcc1 G C 7: 24,566,908 A220P probably benign Het
Other mutations in Abhd16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Abhd16a APN 17 35091037 missense probably damaging 0.96
IGL01943:Abhd16a APN 17 35096483 missense probably benign 0.00
IGL01955:Abhd16a APN 17 35101340 missense probably damaging 1.00
IGL02563:Abhd16a APN 17 35101245 missense probably damaging 1.00
deprived UTSW 17 35098809 critical splice donor site probably null
downtrodden UTSW 17 35101851 missense probably benign 0.12
R0765:Abhd16a UTSW 17 35101851 missense probably benign 0.12
R1931:Abhd16a UTSW 17 35101015 missense probably benign 0.00
R3789:Abhd16a UTSW 17 35101587 missense probably damaging 0.99
R4567:Abhd16a UTSW 17 35096523 missense probably damaging 1.00
R4587:Abhd16a UTSW 17 35101087 critical splice donor site probably null
R4701:Abhd16a UTSW 17 35096606 critical splice donor site probably null
R4736:Abhd16a UTSW 17 35101883 missense probably benign 0.01
R4959:Abhd16a UTSW 17 35102342 missense probably benign 0.26
R4973:Abhd16a UTSW 17 35102342 missense probably benign 0.26
R5338:Abhd16a UTSW 17 35094302 missense probably damaging 1.00
R5896:Abhd16a UTSW 17 35091725 intron probably benign
R6092:Abhd16a UTSW 17 35098810 critical splice donor site probably null
R6533:Abhd16a UTSW 17 35098809 critical splice donor site probably null
R6881:Abhd16a UTSW 17 35096601 missense probably benign 0.00
R7603:Abhd16a UTSW 17 35101960 splice site probably null
Z1177:Abhd16a UTSW 17 35099001 critical splice donor site probably null
Z1177:Abhd16a UTSW 17 35102475 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGACTGGGTGCTGTCAC -3'
(R):5'- GGAACCTTCAGAACAGAGCAGC -3'

Sequencing Primer
(F):5'- CACTGTGTGGGTGGAGATAGGC -3'
(R):5'- TCAGAGAGCCAGGCCACAG -3'
Posted On2015-03-25