Incidental Mutation 'R3788:Sptbn2'
ID 272412
Institutional Source Beutler Lab
Gene Symbol Sptbn2
Ensembl Gene ENSMUSG00000067889
Gene Name spectrin beta, non-erythrocytic 2
Synonyms Spnb3
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3788 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 4761195-4802388 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4795950 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1710 (I1710V)
Ref Sequence ENSEMBL: ENSMUSP00000008991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]
AlphaFold Q68FG2
Predicted Effect probably damaging
Transcript: ENSMUST00000008991
AA Change: I1710V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: I1710V

DomainStartEndE-ValueType
CH 59 159 1.86e-28 SMART
CH 178 276 2.86e-20 SMART
SPEC 308 414 4.63e-1 SMART
SPEC 428 528 3.07e-23 SMART
SPEC 534 638 4.47e-25 SMART
SPEC 644 744 1.28e-25 SMART
SPEC 750 849 4.98e-23 SMART
SPEC 855 955 1.63e-18 SMART
SPEC 961 1062 1.45e-24 SMART
SPEC 1068 1169 4.15e-20 SMART
SPEC 1175 1275 5.26e-22 SMART
SPEC 1281 1380 1.17e-19 SMART
SPEC 1386 1485 2.06e-24 SMART
SPEC 1491 1585 1.74e-22 SMART
SPEC 1591 1691 5.42e-24 SMART
SPEC 1697 1798 2.1e-21 SMART
SPEC 1804 1904 5.47e-20 SMART
SPEC 1910 2010 1.99e-22 SMART
SPEC 2016 2256 2.92e-6 SMART
PH 2219 2330 1.65e-14 SMART
low complexity region 2373 2386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Meta Mutation Damage Score 0.6346 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,846,561 (GRCm39) V26E possibly damaging Het
Abhd16a A G 17: 35,320,563 (GRCm39) N411S probably damaging Het
Akap13 G A 7: 75,351,901 (GRCm39) probably null Het
Aph1b T C 9: 66,701,348 (GRCm39) probably benign Het
Aspm C T 1: 139,390,941 (GRCm39) T742I probably damaging Het
Bclaf3 A G X: 158,349,492 (GRCm39) H619R probably benign Het
Bltp2 T A 11: 78,179,123 (GRCm39) probably null Het
Cemip A T 7: 83,593,106 (GRCm39) L1199H probably damaging Het
Chd2 G A 7: 73,096,878 (GRCm39) probably benign Het
Clnk A G 5: 38,872,341 (GRCm39) Y310H probably damaging Het
Crmp1 A G 5: 37,441,484 (GRCm39) D522G probably damaging Het
Cyth3 A G 5: 143,622,298 (GRCm39) probably benign Het
Dcbld1 T A 10: 52,195,754 (GRCm39) Y392N probably damaging Het
Flnc T C 6: 29,454,056 (GRCm39) F1820L probably damaging Het
Galnt18 G A 7: 111,119,322 (GRCm39) R385* probably null Het
Gpatch3 C A 4: 133,302,479 (GRCm39) R137S possibly damaging Het
Gpc6 C T 14: 117,861,878 (GRCm39) P265S probably damaging Het
Harbi1 T A 2: 91,550,952 (GRCm39) D308E probably benign Het
Hdhd2 G A 18: 77,042,883 (GRCm39) probably null Het
Hk1 T C 10: 62,111,467 (GRCm39) K737E possibly damaging Het
Hnrnpr G A 4: 136,063,624 (GRCm39) V345M probably damaging Het
Ift56 T A 6: 38,380,459 (GRCm39) probably null Het
Kalrn T C 16: 34,040,610 (GRCm39) H944R probably damaging Het
Kdm2a A T 19: 4,401,833 (GRCm39) C207S probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt75 C T 15: 101,481,956 (GRCm39) G104D possibly damaging Het
Lnpk A T 2: 74,352,607 (GRCm39) S358R probably benign Het
Map2 A G 1: 66,456,022 (GRCm39) T1512A probably damaging Het
Marchf10 T A 11: 105,287,905 (GRCm39) L132F probably damaging Het
Mfrp G A 9: 44,016,754 (GRCm39) W65* probably null Het
Mgat5 A G 1: 127,294,180 (GRCm39) D174G probably benign Het
Miga2 T A 2: 30,261,237 (GRCm39) Y177* probably null Het
Mroh3 T C 1: 136,113,213 (GRCm39) D747G probably damaging Het
Muc5b A G 7: 141,417,571 (GRCm39) T3506A possibly damaging Het
Myo7b G T 18: 32,107,165 (GRCm39) P1277T possibly damaging Het
Naaa C T 5: 92,420,413 (GRCm39) probably null Het
Ndufs2 T C 1: 171,062,889 (GRCm39) D410G possibly damaging Het
Or51a25 A G 7: 102,372,694 (GRCm39) probably null Het
Or5p78 T A 7: 108,212,280 (GRCm39) Y255* probably null Het
Or7e177 A G 9: 20,211,666 (GRCm39) I58V probably benign Het
Or8g35 A G 9: 39,381,365 (GRCm39) I219T probably benign Het
Osbp A T 19: 11,956,285 (GRCm39) Y409F probably benign Het
Plxnb1 T A 9: 108,938,355 (GRCm39) V1303D possibly damaging Het
Prkcg G A 7: 3,362,263 (GRCm39) D246N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,169,203 (GRCm39) probably benign Het
Sbf1 G A 15: 89,183,731 (GRCm39) R1261* probably null Het
Scn4a T C 11: 106,235,100 (GRCm39) N341S probably damaging Het
Sec61a2 C A 2: 5,884,436 (GRCm39) probably null Het
Sgcd T A 11: 47,246,032 (GRCm39) K57* probably null Het
Sinhcaf A G 6: 148,827,617 (GRCm39) S134P possibly damaging Het
Slc12a5 T C 2: 164,835,695 (GRCm39) L861P probably damaging Het
Slc6a16 A G 7: 44,909,386 (GRCm39) D184G probably benign Het
Snx7 A G 3: 117,632,639 (GRCm39) probably benign Het
Sytl2 A T 7: 90,025,289 (GRCm39) I426F probably benign Het
Tdp1 A G 12: 99,858,011 (GRCm39) probably benign Het
Tmem232 C A 17: 65,689,628 (GRCm39) D496Y possibly damaging Het
Tomm20l C T 12: 71,158,516 (GRCm39) A58V possibly damaging Het
Ttn T C 2: 76,775,618 (GRCm39) E1854G unknown Het
Ttn A G 2: 76,804,552 (GRCm39) V240A probably benign Het
Vmn2r98 A T 17: 19,300,887 (GRCm39) T630S probably benign Het
Xrcc1 G C 7: 24,266,333 (GRCm39) A220P probably benign Het
Other mutations in Sptbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sptbn2 APN 19 4,774,733 (GRCm39) missense possibly damaging 0.94
IGL00688:Sptbn2 APN 19 4,775,966 (GRCm39) missense probably damaging 1.00
IGL01339:Sptbn2 APN 19 4,796,000 (GRCm39) nonsense probably null
IGL01373:Sptbn2 APN 19 4,796,000 (GRCm39) nonsense probably null
IGL01420:Sptbn2 APN 19 4,784,153 (GRCm39) missense probably benign
IGL01456:Sptbn2 APN 19 4,796,777 (GRCm39) missense probably damaging 1.00
IGL01953:Sptbn2 APN 19 4,799,721 (GRCm39) missense probably benign
IGL03026:Sptbn2 APN 19 4,774,261 (GRCm39) critical splice donor site probably null
IGL03275:Sptbn2 APN 19 4,782,689 (GRCm39) missense possibly damaging 0.65
IGL03286:Sptbn2 APN 19 4,797,860 (GRCm39) missense probably damaging 0.97
F5770:Sptbn2 UTSW 19 4,800,660 (GRCm39) missense probably damaging 1.00
PIT4696001:Sptbn2 UTSW 19 4,795,605 (GRCm39) missense probably benign 0.00
R0046:Sptbn2 UTSW 19 4,795,405 (GRCm39) intron probably benign
R0046:Sptbn2 UTSW 19 4,795,405 (GRCm39) intron probably benign
R0121:Sptbn2 UTSW 19 4,795,321 (GRCm39) missense probably damaging 1.00
R0127:Sptbn2 UTSW 19 4,774,772 (GRCm39) missense probably damaging 1.00
R0212:Sptbn2 UTSW 19 4,796,970 (GRCm39) critical splice donor site probably null
R0277:Sptbn2 UTSW 19 4,795,173 (GRCm39) missense probably benign 0.28
R0417:Sptbn2 UTSW 19 4,787,954 (GRCm39) missense probably benign 0.01
R0457:Sptbn2 UTSW 19 4,795,966 (GRCm39) missense possibly damaging 0.89
R0536:Sptbn2 UTSW 19 4,776,718 (GRCm39) missense probably damaging 0.99
R0631:Sptbn2 UTSW 19 4,790,014 (GRCm39) missense probably benign 0.01
R0734:Sptbn2 UTSW 19 4,798,151 (GRCm39) nonsense probably null
R0742:Sptbn2 UTSW 19 4,769,011 (GRCm39) missense possibly damaging 0.46
R1195:Sptbn2 UTSW 19 4,795,921 (GRCm39) missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4,795,921 (GRCm39) missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4,795,921 (GRCm39) missense possibly damaging 0.85
R1364:Sptbn2 UTSW 19 4,782,693 (GRCm39) missense probably damaging 1.00
R1495:Sptbn2 UTSW 19 4,769,004 (GRCm39) missense possibly damaging 0.92
R1498:Sptbn2 UTSW 19 4,794,274 (GRCm39) missense possibly damaging 0.94
R1606:Sptbn2 UTSW 19 4,800,270 (GRCm39) critical splice donor site probably null
R1678:Sptbn2 UTSW 19 4,800,525 (GRCm39) missense probably damaging 1.00
R1746:Sptbn2 UTSW 19 4,795,992 (GRCm39) nonsense probably null
R1820:Sptbn2 UTSW 19 4,776,624 (GRCm39) missense probably damaging 0.98
R1830:Sptbn2 UTSW 19 4,782,569 (GRCm39) missense probably benign 0.09
R1863:Sptbn2 UTSW 19 4,782,713 (GRCm39) missense possibly damaging 0.54
R1967:Sptbn2 UTSW 19 4,795,327 (GRCm39) missense probably benign 0.00
R2085:Sptbn2 UTSW 19 4,788,587 (GRCm39) missense probably benign 0.09
R2301:Sptbn2 UTSW 19 4,784,166 (GRCm39) missense probably benign 0.00
R2310:Sptbn2 UTSW 19 4,768,963 (GRCm39) missense probably benign 0.19
R2888:Sptbn2 UTSW 19 4,798,664 (GRCm39) missense possibly damaging 0.52
R4429:Sptbn2 UTSW 19 4,788,383 (GRCm39) missense probably damaging 1.00
R4536:Sptbn2 UTSW 19 4,782,630 (GRCm39) missense probably damaging 1.00
R4662:Sptbn2 UTSW 19 4,789,267 (GRCm39) missense probably damaging 1.00
R4672:Sptbn2 UTSW 19 4,782,524 (GRCm39) missense probably benign 0.25
R4731:Sptbn2 UTSW 19 4,792,508 (GRCm39) missense probably damaging 0.96
R4747:Sptbn2 UTSW 19 4,798,182 (GRCm39) missense probably benign 0.27
R4889:Sptbn2 UTSW 19 4,779,458 (GRCm39) missense possibly damaging 0.69
R4891:Sptbn2 UTSW 19 4,788,497 (GRCm39) missense probably damaging 1.00
R4965:Sptbn2 UTSW 19 4,779,337 (GRCm39) missense probably benign 0.13
R4968:Sptbn2 UTSW 19 4,779,230 (GRCm39) splice site probably null
R4981:Sptbn2 UTSW 19 4,801,686 (GRCm39) missense probably benign 0.22
R5159:Sptbn2 UTSW 19 4,787,885 (GRCm39) missense probably benign 0.12
R5202:Sptbn2 UTSW 19 4,774,212 (GRCm39) missense probably damaging 1.00
R5253:Sptbn2 UTSW 19 4,800,110 (GRCm39) missense probably benign 0.01
R5294:Sptbn2 UTSW 19 4,768,936 (GRCm39) missense possibly damaging 0.67
R5465:Sptbn2 UTSW 19 4,800,133 (GRCm39) missense probably benign 0.00
R5546:Sptbn2 UTSW 19 4,775,978 (GRCm39) missense probably damaging 1.00
R5593:Sptbn2 UTSW 19 4,798,975 (GRCm39) missense probably damaging 1.00
R5780:Sptbn2 UTSW 19 4,774,695 (GRCm39) missense probably damaging 1.00
R5835:Sptbn2 UTSW 19 4,788,247 (GRCm39) missense probably damaging 1.00
R6008:Sptbn2 UTSW 19 4,789,306 (GRCm39) missense possibly damaging 0.89
R6108:Sptbn2 UTSW 19 4,781,420 (GRCm39) critical splice donor site probably null
R6236:Sptbn2 UTSW 19 4,798,166 (GRCm39) missense probably benign 0.01
R6307:Sptbn2 UTSW 19 4,774,674 (GRCm39) missense probably damaging 1.00
R6383:Sptbn2 UTSW 19 4,782,524 (GRCm39) missense possibly damaging 0.89
R6397:Sptbn2 UTSW 19 4,792,446 (GRCm39) missense possibly damaging 0.91
R6453:Sptbn2 UTSW 19 4,794,208 (GRCm39) missense possibly damaging 0.67
R6561:Sptbn2 UTSW 19 4,797,954 (GRCm39) missense probably benign 0.39
R6564:Sptbn2 UTSW 19 4,782,052 (GRCm39) missense probably damaging 1.00
R6644:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R6703:Sptbn2 UTSW 19 4,799,843 (GRCm39) missense probably benign
R6703:Sptbn2 UTSW 19 4,799,842 (GRCm39) missense probably benign
R6753:Sptbn2 UTSW 19 4,797,813 (GRCm39) missense probably benign 0.01
R7007:Sptbn2 UTSW 19 4,794,173 (GRCm39) missense possibly damaging 0.82
R7131:Sptbn2 UTSW 19 4,799,488 (GRCm39) missense probably null
R7219:Sptbn2 UTSW 19 4,774,201 (GRCm39) missense probably damaging 1.00
R7285:Sptbn2 UTSW 19 4,787,471 (GRCm39) missense probably benign 0.00
R7308:Sptbn2 UTSW 19 4,801,602 (GRCm39) missense probably benign
R7469:Sptbn2 UTSW 19 4,795,146 (GRCm39) missense probably benign 0.00
R7502:Sptbn2 UTSW 19 4,798,110 (GRCm39) missense probably benign 0.02
R7623:Sptbn2 UTSW 19 4,776,196 (GRCm39) missense probably damaging 1.00
R7635:Sptbn2 UTSW 19 4,794,235 (GRCm39) missense probably damaging 1.00
R7733:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7738:Sptbn2 UTSW 19 4,774,153 (GRCm39) missense probably damaging 1.00
R7742:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7767:Sptbn2 UTSW 19 4,784,171 (GRCm39) missense possibly damaging 0.62
R7795:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7796:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7871:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7877:Sptbn2 UTSW 19 4,794,290 (GRCm39) missense possibly damaging 0.93
R7920:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7921:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7923:Sptbn2 UTSW 19 4,796,827 (GRCm39) missense probably benign 0.01
R8137:Sptbn2 UTSW 19 4,787,431 (GRCm39) missense possibly damaging 0.81
R8305:Sptbn2 UTSW 19 4,779,158 (GRCm39) missense possibly damaging 0.81
R8695:Sptbn2 UTSW 19 4,796,724 (GRCm39) missense possibly damaging 0.86
R8790:Sptbn2 UTSW 19 4,782,052 (GRCm39) missense probably damaging 1.00
R9125:Sptbn2 UTSW 19 4,784,241 (GRCm39) missense probably benign 0.04
R9483:Sptbn2 UTSW 19 4,789,974 (GRCm39) missense probably damaging 1.00
R9620:Sptbn2 UTSW 19 4,800,535 (GRCm39) missense probably damaging 0.99
R9631:Sptbn2 UTSW 19 4,788,218 (GRCm39) missense probably damaging 1.00
R9646:Sptbn2 UTSW 19 4,795,341 (GRCm39) missense probably damaging 1.00
R9694:Sptbn2 UTSW 19 4,800,535 (GRCm39) missense probably damaging 0.99
V7580:Sptbn2 UTSW 19 4,800,660 (GRCm39) missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4,795,219 (GRCm39) missense probably benign 0.01
Z1176:Sptbn2 UTSW 19 4,788,233 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTTGGCAAGCAGTTAGC -3'
(R):5'- GTTGTGCAGAACTCAACTCAAAAC -3'

Sequencing Primer
(F):5'- TAGGTGACACAGAGCAAGCCATTC -3'
(R):5'- AAACCCACCTCCGCTGGTTC -3'
Posted On 2015-03-25