Mutagenetix > Incidental Mutation

Incidental Mutation 'R3789:Stat4'

272415

Institutional Source

Beutler Lab

Gene Symbol

Stat4

Ensembl Gene

ENSMUSG00000062939

Gene Name

signal transducer and activator of transcription 4

Synonyms

MMRRC Submission

041604-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.447) question?

Stock #

R3789 (G1)

Quality Score

144

Status

Not validated

Chromosome

Chromosomal Location

51987148-52107189 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52011796 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 5 (N5D)

Ref Sequence

ENSEMBL: ENSMUSP00000130713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027277
AA Change: N5D

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939
AA Change: N5D

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.73e-60	SMART
Pfam:STAT_alpha	140	314	2.2e-54	PFAM
Pfam:STAT_bind	316	562	4.7e-76	PFAM
SH2	571	681	9.07e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168302
AA Change: N5D

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939
AA Change: N5D

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.73e-60	SMART
Pfam:STAT_alpha	137	314	8.2e-66	PFAM
Pfam:STAT_bind	316	563	3.3e-114	PFAM
SH2	571	681	9.07e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187053

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230104L09Rik	C	A	2: 148,847,958	E92*	probably null	Het
Abca13	T	A	11: 9,510,668	I4226N	probably damaging	Het
Abhd16a	A	G	17: 35,101,587	N411S	probably damaging	Het
Acvrl1	C	T	15: 101,137,469	T292M	probably damaging	Het
Adamts8	T	C	9: 30,959,292	S688P	probably damaging	Het
Adprhl2	A	T	4: 126,316,751	I312N	probably damaging	Het
Bclaf3	A	G	X: 159,566,496	H619R	probably benign	Het
Clca4a	C	A	3: 144,974,956	G20V	probably damaging	Het
Col12a1	C	A	9: 79,639,723	V2276L	possibly damaging	Het
Drosha	T	A	15: 12,912,537	Y1080*	probably null	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Ebf2	T	A	14: 67,239,493		probably null	Het
Emc8	T	C	8: 120,658,130	T195A	probably benign	Het
Fam60a	A	G	6: 148,926,119	S134P	possibly damaging	Het
Frs3	G	A	17: 47,699,696		probably null	Het
Fsip2	T	C	2: 82,982,714	S640P	probably damaging	Het
Hdhd2	G	A	18: 76,955,187		probably null	Het
Hivep3	T	C	4: 120,098,416	S1310P	probably damaging	Het
Hltf	C	T	3: 20,069,047	P200S	probably damaging	Het
Lnpk	A	T	2: 74,522,263	S358R	probably benign	Het
Lrp1	T	C	10: 127,571,969	D1817G	possibly damaging	Het
Lrpprc	T	C	17: 84,771,528	I253V	probably benign	Het
Map2	A	G	1: 66,416,863	T1512A	probably damaging	Het
Mcm9	G	A	10: 53,616,017	R403W	probably damaging	Het
Mms22l	A	G	4: 24,517,115	D222G	possibly damaging	Het
Mug1	G	A	6: 121,884,628	V1350I	probably benign	Het
Olfr663	T	A	7: 104,703,949	D127E	probably damaging	Het
Pclo	A	G	5: 14,680,450		probably benign	Het
Plekha7	A	C	7: 116,175,734	I175R	probably damaging	Het
Plxnb1	T	A	9: 109,109,287	V1303D	possibly damaging	Het
Pou2f1	G	C	1: 165,894,969	P349R	probably damaging	Het
Prmt8	A	T	6: 127,711,147	I236N	probably damaging	Het
Rexo2	A	G	9: 48,473,062	I139T	probably damaging	Het
Rsbn1l	A	C	5: 20,896,108	S811R	probably benign	Het
Sec24b	T	C	3: 130,020,627	D345G	probably benign	Het
Serpina1b	A	G	12: 103,729,272	S337P	probably damaging	Het
Snx33	T	C	9: 56,918,560	E539G	probably benign	Het
Sorcs3	A	G	19: 48,398,711	T212A	possibly damaging	Het
Spa17	T	G	9: 37,611,845	K49Q	possibly damaging	Het
St3gal6	C	T	16: 58,484,773	E109K	probably benign	Het
Tmem232	C	T	17: 65,382,525	D532N	probably benign	Het
Tmem232	C	A	17: 65,382,633	D496Y	possibly damaging	Het
Tmem81	A	G	1: 132,508,071	N205S	probably benign	Het
Tomm20l	C	T	12: 71,111,742	A58V	possibly damaging	Het
Ttn	A	G	2: 76,974,208	V240A	probably benign	Het
Vmn2r23	A	T	6: 123,741,389	N567I	probably damaging	Het

Other mutations in Stat4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Stat4	APN	1	52102878	missense	probably damaging	1.00
IGL00482:Stat4	APN	1	52074697	missense	probably benign	0.05
IGL01395:Stat4	APN	1	52011874	missense	probably damaging	1.00
IGL01533:Stat4	APN	1	52098419	missense	probably damaging	1.00
IGL01943:Stat4	APN	1	52096855	missense	possibly damaging	0.94
IGL02114:Stat4	APN	1	52102865	missense	probably damaging	1.00
IGL02151:Stat4	APN	1	52013870	missense	probably damaging	0.99
IGL02601:Stat4	APN	1	52098415	missense	probably damaging	1.00
R0016:Stat4	UTSW	1	52068780	missense	probably benign	0.01
R0243:Stat4	UTSW	1	52011857	missense	probably benign	0.22
R0329:Stat4	UTSW	1	52090870	intron	probably benign
R0973:Stat4	UTSW	1	52096820	missense	probably damaging	0.99
R1144:Stat4	UTSW	1	52084129	splice site	probably benign
R1187:Stat4	UTSW	1	52076677	missense	probably damaging	1.00
R1331:Stat4	UTSW	1	52013927	missense	probably benign	0.20
R1401:Stat4	UTSW	1	52071947	splice site	probably benign
R1529:Stat4	UTSW	1	52011793	missense	probably damaging	1.00
R1711:Stat4	UTSW	1	52106925	missense	probably damaging	1.00
R2213:Stat4	UTSW	1	52013855	missense	probably damaging	0.98
R3003:Stat4	UTSW	1	52102986	missense	probably damaging	1.00
R3683:Stat4	UTSW	1	52013822	missense	possibly damaging	0.89
R3919:Stat4	UTSW	1	52096822	missense	possibly damaging	0.62
R4320:Stat4	UTSW	1	52074707	missense	probably benign
R4373:Stat4	UTSW	1	52071941	critical splice donor site	probably null
R5024:Stat4	UTSW	1	52082570	missense	possibly damaging	0.80
R5103:Stat4	UTSW	1	52071895	missense	probably damaging	0.97
R5206:Stat4	UTSW	1	52105236	missense	probably damaging	0.99
R5944:Stat4	UTSW	1	52074739	missense	probably damaging	1.00
R5961:Stat4	UTSW	1	52065384	missense	possibly damaging	0.50
R6001:Stat4	UTSW	1	52096867	missense	probably damaging	0.96
R6161:Stat4	UTSW	1	52074677	missense	possibly damaging	0.94
R6262:Stat4	UTSW	1	52102201	missense	probably null	1.00
R6701:Stat4	UTSW	1	52102974	missense	probably damaging	1.00
R6767:Stat4	UTSW	1	52076583	missense	probably benign	0.00
R6989:Stat4	UTSW	1	52068815	missense	probably benign	0.09
R7507:Stat4	UTSW	1	52078574	missense	probably damaging	1.00
R7539:Stat4	UTSW	1	52071709	splice site	probably null
R7546:Stat4	UTSW	1	52098463	missense	probably damaging	0.98
R7616:Stat4	UTSW	1	52013878	nonsense	probably null
R7751:Stat4	UTSW	1	52082552	missense	possibly damaging	0.73
R8052:Stat4	UTSW	1	52079773	missense	probably damaging	1.00
R8311:Stat4	UTSW	1	52102916	missense	probably damaging	1.00
R8419:Stat4	UTSW	1	52098478	missense	possibly damaging	0.89
R8679:Stat4	UTSW	1	52079832	missense	probably null	1.00
R8699:Stat4	UTSW	1	52071937	missense	probably benign
R8738:Stat4	UTSW	1	52076552	missense	possibly damaging	0.95
R8921:Stat4	UTSW	1	52105733	missense	probably benign	0.39
R9013:Stat4	UTSW	1	52011798	missense	probably benign	0.00
R9237:Stat4	UTSW	1	52106914	missense	probably benign
R9729:Stat4	UTSW	1	52102603	missense	possibly damaging	0.94
R9767:Stat4	UTSW	1	52102494	missense	probably damaging	1.00
Z1177:Stat4	UTSW	1	52084099	nonsense	probably null
Z1177:Stat4	UTSW	1	52098485	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AGCAAACACTGGATGCTGAG -3'
(R):5'- CCAAAAGGAATGCATCTACTCAGTC -3'

Sequencing Primer
(F):5'- CACTGGATGCTGAGTTTTAAATGC -3'
(R):5'- GGCCATAGAATATATGACTAGGACAC -3'

Posted On

2015-03-25