Incidental Mutation 'R3789:Map2'
ID 272416
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Name microtubule-associated protein 2
Synonyms G1-397-34, MAP-2, Mtap2, repro4
MMRRC Submission 041604-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.679) question?
Stock # R3789 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 66214432-66481742 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66456022 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1512 (T1512A)
Ref Sequence ENSEMBL: ENSMUSP00000109646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000173800] [ENSMUST00000173778] [ENSMUST00000145419] [ENSMUST00000173855] [ENSMUST00000172886]
AlphaFold P20357
Predicted Effect probably benign
Transcript: ENSMUST00000024639
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077355
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114012
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114013
AA Change: T1512A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222
AA Change: T1512A

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114015
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114017
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114018
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173800
AA Change: T25A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134518
Gene: ENSMUSG00000015222
AA Change: T25A

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 23 2.2e-11 PFAM
low complexity region 55 69 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 102 124 N/A INTRINSIC
Pfam:Tubulin-binding 173 204 8.7e-19 PFAM
Pfam:Tubulin-binding 205 235 3.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133522
Predicted Effect probably benign
Transcript: ENSMUST00000173778
AA Change: T126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134651
Gene: ENSMUSG00000015222
AA Change: T126A

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 124 4.8e-84 PFAM
low complexity region 157 171 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Pfam:Tubulin-binding 275 306 1.6e-18 PFAM
Pfam:Tubulin-binding 307 337 1.6e-19 PFAM
Pfam:Tubulin-binding 338 368 7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151423
Predicted Effect probably benign
Transcript: ENSMUST00000145419
SMART Domains Protein: ENSMUSP00000134538
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 218 608 1.7e-250 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141148
SMART Domains Protein: ENSMUSP00000117996
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:RII_binding_1 23 40 3.2e-6 PFAM
low complexity region 70 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173855
SMART Domains Protein: ENSMUSP00000134471
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 142 163 N/A INTRINSIC
Pfam:MAP2_projctn 458 565 1.1e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172886
SMART Domains Protein: ENSMUSP00000133446
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 107 3.9e-54 PFAM
low complexity region 112 126 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 159 181 N/A INTRINSIC
Pfam:Tubulin-binding 230 261 1.4e-18 PFAM
Pfam:Tubulin-binding 262 292 1.4e-19 PFAM
Pfam:Tubulin-binding 293 323 6e-20 PFAM
Meta Mutation Damage Score 0.1422 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,460,668 (GRCm39) I4226N probably damaging Het
Abhd16a A G 17: 35,320,563 (GRCm39) N411S probably damaging Het
Acvrl1 C T 15: 101,035,350 (GRCm39) T292M probably damaging Het
Adamts8 T C 9: 30,870,588 (GRCm39) S688P probably damaging Het
Adprs A T 4: 126,210,544 (GRCm39) I312N probably damaging Het
Bclaf3 A G X: 158,349,492 (GRCm39) H619R probably benign Het
Clca4a C A 3: 144,680,717 (GRCm39) G20V probably damaging Het
Col12a1 C A 9: 79,547,005 (GRCm39) V2276L possibly damaging Het
Cstdc2 C A 2: 148,689,878 (GRCm39) E92* probably null Het
Drosha T A 15: 12,912,623 (GRCm39) Y1080* probably null Het
Dysf G A 6: 84,163,491 (GRCm39) probably null Het
Ebf2 T A 14: 67,476,942 (GRCm39) probably null Het
Emc8 T C 8: 121,384,869 (GRCm39) T195A probably benign Het
Frs3 G A 17: 48,010,621 (GRCm39) probably null Het
Fsip2 T C 2: 82,813,058 (GRCm39) S640P probably damaging Het
Hdhd2 G A 18: 77,042,883 (GRCm39) probably null Het
Hivep3 T C 4: 119,955,613 (GRCm39) S1310P probably damaging Het
Hltf C T 3: 20,123,211 (GRCm39) P200S probably damaging Het
Lnpk A T 2: 74,352,607 (GRCm39) S358R probably benign Het
Lrp1 T C 10: 127,407,838 (GRCm39) D1817G possibly damaging Het
Lrpprc T C 17: 85,078,956 (GRCm39) I253V probably benign Het
Mcm9 G A 10: 53,492,113 (GRCm39) R403W probably damaging Het
Mms22l A G 4: 24,517,115 (GRCm39) D222G possibly damaging Het
Mug1 G A 6: 121,861,587 (GRCm39) V1350I probably benign Het
Or56b2j T A 7: 104,353,156 (GRCm39) D127E probably damaging Het
Pclo A G 5: 14,730,464 (GRCm39) probably benign Het
Plekha7 A C 7: 115,774,969 (GRCm39) I175R probably damaging Het
Plxnb1 T A 9: 108,938,355 (GRCm39) V1303D possibly damaging Het
Pou2f1 G C 1: 165,722,538 (GRCm39) P349R probably damaging Het
Prmt8 A T 6: 127,688,110 (GRCm39) I236N probably damaging Het
Rexo2 A G 9: 48,384,362 (GRCm39) I139T probably damaging Het
Rsbn1l A C 5: 21,101,106 (GRCm39) S811R probably benign Het
Sec24b T C 3: 129,814,276 (GRCm39) D345G probably benign Het
Serpina1b A G 12: 103,695,531 (GRCm39) S337P probably damaging Het
Sinhcaf A G 6: 148,827,617 (GRCm39) S134P possibly damaging Het
Snx33 T C 9: 56,825,844 (GRCm39) E539G probably benign Het
Sorcs3 A G 19: 48,387,150 (GRCm39) T212A possibly damaging Het
Spa17 T G 9: 37,523,141 (GRCm39) K49Q possibly damaging Het
St3gal6 C T 16: 58,305,136 (GRCm39) E109K probably benign Het
Stat4 A G 1: 52,050,955 (GRCm39) N5D probably benign Het
Tmem232 C T 17: 65,689,520 (GRCm39) D532N probably benign Het
Tmem232 C A 17: 65,689,628 (GRCm39) D496Y possibly damaging Het
Tmem81 A G 1: 132,435,809 (GRCm39) N205S probably benign Het
Tomm20l C T 12: 71,158,516 (GRCm39) A58V possibly damaging Het
Ttn A G 2: 76,804,552 (GRCm39) V240A probably benign Het
Vmn2r23 A T 6: 123,718,348 (GRCm39) N567I probably damaging Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66,464,490 (GRCm39) missense probably damaging 1.00
IGL02135:Map2 APN 1 66,419,920 (GRCm39) nonsense probably null
IGL02526:Map2 APN 1 66,419,876 (GRCm39) missense possibly damaging 0.94
Annas UTSW 1 66,472,756 (GRCm39) critical splice donor site probably null
calliope UTSW 1 66,464,457 (GRCm39) missense probably damaging 1.00
carthage UTSW 1 66,453,807 (GRCm39) missense probably damaging 1.00
costas UTSW 1 66,451,812 (GRCm39) missense possibly damaging 0.94
Jacobin UTSW 1 66,438,578 (GRCm39) missense probably damaging 1.00
Nectar UTSW 1 66,454,522 (GRCm39) nonsense probably null
ruby_throat UTSW 1 66,454,043 (GRCm39) missense possibly damaging 0.67
Rufous UTSW 1 66,419,927 (GRCm39) missense probably damaging 1.00
Speckled UTSW 1 66,451,886 (GRCm39) nonsense probably null
Sunbird UTSW 1 66,454,646 (GRCm39) missense probably benign 0.01
swift UTSW 1 66,455,523 (GRCm39) missense probably damaging 1.00
E0370:Map2 UTSW 1 66,455,883 (GRCm39) unclassified probably benign
PIT4362001:Map2 UTSW 1 66,451,677 (GRCm39) missense probably benign 0.05
R0067:Map2 UTSW 1 66,452,322 (GRCm39) missense probably benign 0.04
R0238:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0238:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0239:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0239:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0268:Map2 UTSW 1 66,419,881 (GRCm39) nonsense probably null
R0302:Map2 UTSW 1 66,453,987 (GRCm39) missense probably benign 0.15
R0305:Map2 UTSW 1 66,452,253 (GRCm39) missense probably benign 0.00
R0409:Map2 UTSW 1 66,472,739 (GRCm39) missense probably damaging 1.00
R0561:Map2 UTSW 1 66,464,656 (GRCm39) missense probably damaging 1.00
R0674:Map2 UTSW 1 66,452,361 (GRCm39) missense probably damaging 1.00
R0738:Map2 UTSW 1 66,464,348 (GRCm39) splice site probably benign
R0893:Map2 UTSW 1 66,419,927 (GRCm39) missense probably damaging 1.00
R1305:Map2 UTSW 1 66,464,554 (GRCm39) missense probably damaging 1.00
R1534:Map2 UTSW 1 66,452,339 (GRCm39) missense probably benign 0.33
R1632:Map2 UTSW 1 66,454,245 (GRCm39) missense possibly damaging 0.60
R1682:Map2 UTSW 1 66,454,781 (GRCm39) splice site probably null
R1774:Map2 UTSW 1 66,453,233 (GRCm39) missense probably damaging 1.00
R2014:Map2 UTSW 1 66,455,295 (GRCm39) missense possibly damaging 0.55
R2017:Map2 UTSW 1 66,451,958 (GRCm39) missense probably damaging 1.00
R2050:Map2 UTSW 1 66,453,473 (GRCm39) missense probably damaging 0.98
R2093:Map2 UTSW 1 66,438,599 (GRCm39) missense probably damaging 1.00
R2214:Map2 UTSW 1 66,459,345 (GRCm39) missense probably damaging 0.99
R2284:Map2 UTSW 1 66,453,227 (GRCm39) missense probably damaging 1.00
R3011:Map2 UTSW 1 66,453,771 (GRCm39) missense probably damaging 1.00
R3105:Map2 UTSW 1 66,472,756 (GRCm39) critical splice donor site probably null
R3708:Map2 UTSW 1 66,455,714 (GRCm39) unclassified probably benign
R3709:Map2 UTSW 1 66,455,015 (GRCm39) nonsense probably null
R3729:Map2 UTSW 1 66,451,605 (GRCm39) missense possibly damaging 0.80
R3760:Map2 UTSW 1 66,478,077 (GRCm39) missense probably damaging 1.00
R3788:Map2 UTSW 1 66,456,022 (GRCm39) missense probably damaging 0.99
R4003:Map2 UTSW 1 66,454,899 (GRCm39) missense probably damaging 1.00
R4120:Map2 UTSW 1 66,455,063 (GRCm39) missense probably damaging 1.00
R4172:Map2 UTSW 1 66,452,759 (GRCm39) missense possibly damaging 0.89
R4198:Map2 UTSW 1 66,464,457 (GRCm39) missense probably damaging 1.00
R4200:Map2 UTSW 1 66,464,457 (GRCm39) missense probably damaging 1.00
R4205:Map2 UTSW 1 66,464,449 (GRCm39) missense probably damaging 1.00
R4613:Map2 UTSW 1 66,464,628 (GRCm39) missense probably damaging 1.00
R4700:Map2 UTSW 1 66,449,796 (GRCm39) missense probably damaging 0.96
R4974:Map2 UTSW 1 66,452,664 (GRCm39) missense probably benign 0.15
R5007:Map2 UTSW 1 66,452,448 (GRCm39) missense possibly damaging 0.86
R5039:Map2 UTSW 1 66,477,955 (GRCm39) missense probably damaging 1.00
R5237:Map2 UTSW 1 66,478,169 (GRCm39) unclassified probably benign
R5313:Map2 UTSW 1 66,464,538 (GRCm39) missense probably damaging 1.00
R5455:Map2 UTSW 1 66,438,550 (GRCm39) missense probably damaging 1.00
R5490:Map2 UTSW 1 66,452,292 (GRCm39) missense probably damaging 1.00
R5517:Map2 UTSW 1 66,454,415 (GRCm39) missense probably benign 0.00
R5532:Map2 UTSW 1 66,453,779 (GRCm39) missense probably damaging 1.00
R5583:Map2 UTSW 1 66,455,196 (GRCm39) missense probably damaging 1.00
R5764:Map2 UTSW 1 66,454,034 (GRCm39) missense probably damaging 0.99
R5996:Map2 UTSW 1 66,454,043 (GRCm39) missense possibly damaging 0.67
R6058:Map2 UTSW 1 66,454,573 (GRCm39) missense probably benign 0.05
R6199:Map2 UTSW 1 66,464,637 (GRCm39) missense probably damaging 1.00
R6208:Map2 UTSW 1 66,470,749 (GRCm39) missense probably damaging 1.00
R6276:Map2 UTSW 1 66,438,578 (GRCm39) missense probably damaging 1.00
R6378:Map2 UTSW 1 66,454,488 (GRCm39) missense probably damaging 1.00
R6424:Map2 UTSW 1 66,453,946 (GRCm39) missense possibly damaging 0.67
R6743:Map2 UTSW 1 66,454,766 (GRCm39) missense probably benign 0.04
R6837:Map2 UTSW 1 66,453,731 (GRCm39) missense probably damaging 1.00
R6901:Map2 UTSW 1 66,460,932 (GRCm39) missense possibly damaging 0.94
R6984:Map2 UTSW 1 66,454,395 (GRCm39) missense possibly damaging 0.90
R6989:Map2 UTSW 1 66,454,065 (GRCm39) missense probably benign 0.00
R7001:Map2 UTSW 1 66,454,646 (GRCm39) missense probably benign 0.01
R7055:Map2 UTSW 1 66,455,983 (GRCm39) missense probably damaging 1.00
R7094:Map2 UTSW 1 66,451,886 (GRCm39) nonsense probably null
R7106:Map2 UTSW 1 66,449,903 (GRCm39) missense possibly damaging 0.92
R7182:Map2 UTSW 1 66,451,812 (GRCm39) missense possibly damaging 0.94
R7235:Map2 UTSW 1 66,453,807 (GRCm39) missense probably damaging 1.00
R7424:Map2 UTSW 1 66,453,983 (GRCm39) missense possibly damaging 0.69
R7473:Map2 UTSW 1 66,454,617 (GRCm39) missense probably damaging 1.00
R7642:Map2 UTSW 1 66,452,466 (GRCm39) missense probably benign 0.01
R7660:Map2 UTSW 1 66,453,536 (GRCm39) missense probably damaging 1.00
R7673:Map2 UTSW 1 66,452,933 (GRCm39) missense probably benign 0.03
R7768:Map2 UTSW 1 66,453,642 (GRCm39) missense possibly damaging 0.94
R7796:Map2 UTSW 1 66,455,654 (GRCm39) splice site probably null
R7834:Map2 UTSW 1 66,455,647 (GRCm39) missense probably damaging 1.00
R7842:Map2 UTSW 1 66,455,570 (GRCm39) missense probably benign
R7955:Map2 UTSW 1 66,452,875 (GRCm39) missense probably damaging 1.00
R8056:Map2 UTSW 1 66,454,779 (GRCm39) missense probably damaging 0.99
R8118:Map2 UTSW 1 66,464,550 (GRCm39) missense probably damaging 1.00
R8135:Map2 UTSW 1 66,452,828 (GRCm39) missense probably damaging 1.00
R8152:Map2 UTSW 1 66,453,902 (GRCm39) missense probably benign 0.00
R8223:Map2 UTSW 1 66,464,649 (GRCm39) missense probably damaging 1.00
R8329:Map2 UTSW 1 66,454,272 (GRCm39) missense probably benign 0.01
R8344:Map2 UTSW 1 66,460,872 (GRCm39) missense probably damaging 1.00
R8475:Map2 UTSW 1 66,453,164 (GRCm39) missense probably damaging 1.00
R8548:Map2 UTSW 1 66,452,499 (GRCm39) missense probably damaging 1.00
R8680:Map2 UTSW 1 66,460,872 (GRCm39) missense probably damaging 1.00
R8713:Map2 UTSW 1 66,453,781 (GRCm39) missense probably damaging 1.00
R8745:Map2 UTSW 1 66,452,556 (GRCm39) missense probably benign 0.00
R8786:Map2 UTSW 1 66,472,755 (GRCm39) critical splice donor site probably benign
R8790:Map2 UTSW 1 66,477,997 (GRCm39) missense probably damaging 1.00
R8874:Map2 UTSW 1 66,455,523 (GRCm39) missense probably damaging 1.00
R8887:Map2 UTSW 1 66,454,758 (GRCm39) missense possibly damaging 0.48
R8948:Map2 UTSW 1 66,419,684 (GRCm39) missense probably damaging 1.00
R8950:Map2 UTSW 1 66,419,684 (GRCm39) missense probably damaging 1.00
R8998:Map2 UTSW 1 66,452,473 (GRCm39) missense possibly damaging 0.91
R8999:Map2 UTSW 1 66,452,473 (GRCm39) missense possibly damaging 0.91
R9072:Map2 UTSW 1 66,453,312 (GRCm39) missense probably damaging 1.00
R9088:Map2 UTSW 1 66,453,773 (GRCm39) missense probably damaging 1.00
R9089:Map2 UTSW 1 66,452,098 (GRCm39) missense probably benign 0.09
R9106:Map2 UTSW 1 66,454,522 (GRCm39) nonsense probably null
R9112:Map2 UTSW 1 66,472,723 (GRCm39) nonsense probably null
R9120:Map2 UTSW 1 66,453,218 (GRCm39) missense probably damaging 1.00
R9161:Map2 UTSW 1 66,477,503 (GRCm39) missense possibly damaging 0.65
R9464:Map2 UTSW 1 66,454,497 (GRCm39) missense probably damaging 1.00
R9589:Map2 UTSW 1 66,449,753 (GRCm39) missense probably benign
V8831:Map2 UTSW 1 66,455,004 (GRCm39) missense probably damaging 1.00
Z1177:Map2 UTSW 1 66,477,520 (GRCm39) missense probably damaging 0.96
Z1177:Map2 UTSW 1 66,419,839 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACAAAGCAACTTGCCTAACTAG -3'
(R):5'- ATGACCTCTTCTGCAGGGAG -3'

Sequencing Primer
(F):5'- CAAGTGTTTGCTTTCTTTCCTGATG -3'
(R):5'- GAAACTGTTCATGATTGCTG -3'
Posted On 2015-03-25