Incidental Mutation 'R3789:Tmem81'
ID 272417
Institutional Source Beutler Lab
Gene Symbol Tmem81
Ensembl Gene ENSMUSG00000048174
Gene Name transmembrane protein 81
Synonyms 4930429O20Rik
MMRRC Submission 041604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock # R3789 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 132506230-132508639 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 132508071 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 205 (N205S)
Ref Sequence ENSEMBL: ENSMUSP00000139911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027700] [ENSMUST00000058167] [ENSMUST00000086521] [ENSMUST00000187505] [ENSMUST00000188789] [ENSMUST00000190825] [ENSMUST00000190997]
AlphaFold Q9D5K1
Predicted Effect probably benign
Transcript: ENSMUST00000027700
SMART Domains Protein: ENSMUSP00000027700
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058167
AA Change: N205S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000062565
Gene: ENSMUSG00000048174
AA Change: N205S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:IG 86 178 6e-54 BLAST
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086521
SMART Domains Protein: ENSMUSP00000083707
Gene: ENSMUSG00000053024

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 54 120 8.78e-9 SMART
IG 142 232 3.89e-1 SMART
IGc2 254 315 2.14e-21 SMART
IGc2 341 404 4.59e-12 SMART
IGc2 433 497 7.52e-8 SMART
IGc2 523 596 2.72e-5 SMART
FN3 610 696 2.72e-12 SMART
FN3 713 799 1.02e-2 SMART
FN3 815 899 5.27e-10 SMART
FN3 915 995 8.91e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186487
Predicted Effect probably benign
Transcript: ENSMUST00000187505
SMART Domains Protein: ENSMUSP00000141176
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
Blast:WD40 1 52 9e-13 BLAST
WD40 55 99 5.1e-3 SMART
WD40 114 153 7.9e-2 SMART
WD40 156 195 1.9e-2 SMART
low complexity region 217 231 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187834
Predicted Effect probably benign
Transcript: ENSMUST00000188065
Predicted Effect probably benign
Transcript: ENSMUST00000188789
AA Change: N205S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139911
Gene: ENSMUSG00000048174
AA Change: N205S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:IG 86 178 6e-54 BLAST
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190601
Predicted Effect probably benign
Transcript: ENSMUST00000190825
SMART Domains Protein: ENSMUSP00000139519
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 1.4e-3 SMART
WD40 55 94 4.6e-9 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 5.1e-3 SMART
WD40 241 280 7.9e-2 SMART
WD40 283 322 1.9e-2 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190997
SMART Domains Protein: ENSMUSP00000141003
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C A 2: 148,847,958 E92* probably null Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Acvrl1 C T 15: 101,137,469 T292M probably damaging Het
Adamts8 T C 9: 30,959,292 S688P probably damaging Het
Adprhl2 A T 4: 126,316,751 I312N probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Clca4a C A 3: 144,974,956 G20V probably damaging Het
Col12a1 C A 9: 79,639,723 V2276L possibly damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dysf G A 6: 84,186,509 probably null Het
Ebf2 T A 14: 67,239,493 probably null Het
Emc8 T C 8: 120,658,130 T195A probably benign Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Frs3 G A 17: 47,699,696 probably null Het
Fsip2 T C 2: 82,982,714 S640P probably damaging Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hivep3 T C 4: 120,098,416 S1310P probably damaging Het
Hltf C T 3: 20,069,047 P200S probably damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lrp1 T C 10: 127,571,969 D1817G possibly damaging Het
Lrpprc T C 17: 84,771,528 I253V probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
Mcm9 G A 10: 53,616,017 R403W probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Olfr663 T A 7: 104,703,949 D127E probably damaging Het
Pclo A G 5: 14,680,450 probably benign Het
Plekha7 A C 7: 116,175,734 I175R probably damaging Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Rexo2 A G 9: 48,473,062 I139T probably damaging Het
Rsbn1l A C 5: 20,896,108 S811R probably benign Het
Sec24b T C 3: 130,020,627 D345G probably benign Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Snx33 T C 9: 56,918,560 E539G probably benign Het
Sorcs3 A G 19: 48,398,711 T212A possibly damaging Het
Spa17 T G 9: 37,611,845 K49Q possibly damaging Het
St3gal6 C T 16: 58,484,773 E109K probably benign Het
Stat4 A G 1: 52,011,796 N5D probably benign Het
Tmem232 C T 17: 65,382,525 D532N probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r23 A T 6: 123,741,389 N567I probably damaging Het
Other mutations in Tmem81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01918:Tmem81 APN 1 132507960 missense probably damaging 1.00
R0094:Tmem81 UTSW 1 132508049 missense probably benign 0.00
R0255:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0432:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0531:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0532:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0551:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0614:Tmem81 UTSW 1 132507731 missense probably benign 0.01
R0651:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0696:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0973:Tmem81 UTSW 1 132507924 missense probably damaging 1.00
R1663:Tmem81 UTSW 1 132507897 missense probably benign 0.05
R1750:Tmem81 UTSW 1 132507583 missense probably damaging 0.98
R1881:Tmem81 UTSW 1 132508210 unclassified probably benign
R2074:Tmem81 UTSW 1 132507906 missense probably damaging 0.98
R2121:Tmem81 UTSW 1 132508109 missense probably benign 0.00
R3003:Tmem81 UTSW 1 132508014 missense probably benign 0.38
R4638:Tmem81 UTSW 1 132508205 unclassified probably benign
R7162:Tmem81 UTSW 1 132507617 missense probably damaging 1.00
R7375:Tmem81 UTSW 1 132507563 missense possibly damaging 0.76
R7527:Tmem81 UTSW 1 132508146 missense probably benign 0.34
R7586:Tmem81 UTSW 1 132507773 missense probably damaging 0.99
Z1176:Tmem81 UTSW 1 132508211 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTTTTCAGACCCTTCCGAG -3'
(R):5'- AGACTTGCATCATAAGCGGG -3'

Sequencing Primer
(F):5'- TAAACCAGCCTATGAGTATAACGCTG -3'
(R):5'- CAATTCCTATGCCCAAGG -3'
Posted On 2015-03-25