Incidental Mutation 'R3789:9230104L09Rik'
ID 272422
Institutional Source Beutler Lab
Gene Symbol 9230104L09Rik
Ensembl Gene ENSMUSG00000027446
Gene Name RIKEN cDNA 9230104L09 gene
Synonyms mCST E2
MMRRC Submission 041604-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3789 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 148846711-148865038 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 148847958 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 92 (E92*)
Ref Sequence ENSEMBL: ENSMUSP00000028937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028937]
AlphaFold Q9D264
Predicted Effect probably null
Transcript: ENSMUST00000028937
AA Change: E92*
SMART Domains Protein: ENSMUSP00000028937
Gene: ENSMUSG00000027446
AA Change: E92*

DomainStartEndE-ValueType
Pfam:Cystatin 35 118 3.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149457
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Acvrl1 C T 15: 101,137,469 T292M probably damaging Het
Adamts8 T C 9: 30,959,292 S688P probably damaging Het
Adprhl2 A T 4: 126,316,751 I312N probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Clca4a C A 3: 144,974,956 G20V probably damaging Het
Col12a1 C A 9: 79,639,723 V2276L possibly damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dysf G A 6: 84,186,509 probably null Het
Ebf2 T A 14: 67,239,493 probably null Het
Emc8 T C 8: 120,658,130 T195A probably benign Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Frs3 G A 17: 47,699,696 probably null Het
Fsip2 T C 2: 82,982,714 S640P probably damaging Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hivep3 T C 4: 120,098,416 S1310P probably damaging Het
Hltf C T 3: 20,069,047 P200S probably damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lrp1 T C 10: 127,571,969 D1817G possibly damaging Het
Lrpprc T C 17: 84,771,528 I253V probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
Mcm9 G A 10: 53,616,017 R403W probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Olfr663 T A 7: 104,703,949 D127E probably damaging Het
Pclo A G 5: 14,680,450 probably benign Het
Plekha7 A C 7: 116,175,734 I175R probably damaging Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Rexo2 A G 9: 48,473,062 I139T probably damaging Het
Rsbn1l A C 5: 20,896,108 S811R probably benign Het
Sec24b T C 3: 130,020,627 D345G probably benign Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Snx33 T C 9: 56,918,560 E539G probably benign Het
Sorcs3 A G 19: 48,398,711 T212A possibly damaging Het
Spa17 T G 9: 37,611,845 K49Q possibly damaging Het
St3gal6 C T 16: 58,484,773 E109K probably benign Het
Stat4 A G 1: 52,011,796 N5D probably benign Het
Tmem232 C T 17: 65,382,525 D532N probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tmem81 A G 1: 132,508,071 N205S probably benign Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r23 A T 6: 123,741,389 N567I probably damaging Het
Other mutations in 9230104L09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02414:9230104L09Rik APN 2 148850678 missense possibly damaging 0.70
R2973:9230104L09Rik UTSW 2 148850786 missense probably benign 0.20
R2974:9230104L09Rik UTSW 2 148850786 missense probably benign 0.20
R3802:9230104L09Rik UTSW 2 148850696 missense probably benign 0.02
R4796:9230104L09Rik UTSW 2 148850738 missense probably damaging 0.99
R6330:9230104L09Rik UTSW 2 148850825 missense probably damaging 0.99
R6623:9230104L09Rik UTSW 2 148850762 missense probably benign 0.05
R7440:9230104L09Rik UTSW 2 148846991 missense probably damaging 1.00
R7809:9230104L09Rik UTSW 2 148846990 missense probably damaging 0.99
R9169:9230104L09Rik UTSW 2 148850669 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCCTCTGTAGCTTGCATC -3'
(R):5'- TTAAGAAGGGAATGCTAGACCTTG -3'

Sequencing Primer
(F):5'- GCCCTTAAGACTTAAGAAGGAATTCG -3'
(R):5'- GGAATGCTAGACCTTGGAAAAACTCC -3'
Posted On 2015-03-25