Incidental Mutation 'R3789:Rsbn1l'
ID 272431
Institutional Source Beutler Lab
Gene Symbol Rsbn1l
Ensembl Gene ENSMUSG00000039968
Gene Name round spermatid basic protein 1-like
Synonyms C330002G24Rik, 8430412F05Rik
MMRRC Submission 041604-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock # R3789 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 20893028-20956398 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 20896108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 811 (S811R)
Ref Sequence ENSEMBL: ENSMUSP00000039482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036489] [ENSMUST00000196780]
AlphaFold D3Z0K6
Predicted Effect probably benign
Transcript: ENSMUST00000036489
AA Change: S811R

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039482
Gene: ENSMUSG00000039968
AA Change: S811R

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 71 109 N/A INTRINSIC
low complexity region 136 156 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 229 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196780
SMART Domains Protein: ENSMUSP00000142789
Gene: ENSMUSG00000039968

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 71 109 N/A INTRINSIC
low complexity region 136 156 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 229 249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C A 2: 148,847,958 E92* probably null Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Acvrl1 C T 15: 101,137,469 T292M probably damaging Het
Adamts8 T C 9: 30,959,292 S688P probably damaging Het
Adprhl2 A T 4: 126,316,751 I312N probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Clca4a C A 3: 144,974,956 G20V probably damaging Het
Col12a1 C A 9: 79,639,723 V2276L possibly damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dysf G A 6: 84,186,509 probably null Het
Ebf2 T A 14: 67,239,493 probably null Het
Emc8 T C 8: 120,658,130 T195A probably benign Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Frs3 G A 17: 47,699,696 probably null Het
Fsip2 T C 2: 82,982,714 S640P probably damaging Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hivep3 T C 4: 120,098,416 S1310P probably damaging Het
Hltf C T 3: 20,069,047 P200S probably damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lrp1 T C 10: 127,571,969 D1817G possibly damaging Het
Lrpprc T C 17: 84,771,528 I253V probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
Mcm9 G A 10: 53,616,017 R403W probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Olfr663 T A 7: 104,703,949 D127E probably damaging Het
Pclo A G 5: 14,680,450 probably benign Het
Plekha7 A C 7: 116,175,734 I175R probably damaging Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Rexo2 A G 9: 48,473,062 I139T probably damaging Het
Sec24b T C 3: 130,020,627 D345G probably benign Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Snx33 T C 9: 56,918,560 E539G probably benign Het
Sorcs3 A G 19: 48,398,711 T212A possibly damaging Het
Spa17 T G 9: 37,611,845 K49Q possibly damaging Het
St3gal6 C T 16: 58,484,773 E109K probably benign Het
Stat4 A G 1: 52,011,796 N5D probably benign Het
Tmem232 C T 17: 65,382,525 D532N probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tmem81 A G 1: 132,508,071 N205S probably benign Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r23 A T 6: 123,741,389 N567I probably damaging Het
Other mutations in Rsbn1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Rsbn1l APN 5 20896155 missense probably benign 0.08
IGL01631:Rsbn1l APN 5 20896571 missense probably damaging 1.00
IGL01631:Rsbn1l APN 5 20896572 missense probably damaging 1.00
IGL02237:Rsbn1l APN 5 20919606 missense probably benign 0.39
IGL02434:Rsbn1l APN 5 20919734 missense probably damaging 0.99
IGL02458:Rsbn1l APN 5 20951736 missense probably damaging 0.99
IGL02994:Rsbn1l APN 5 20908234 missense probably damaging 1.00
PIT4280001:Rsbn1l UTSW 5 20919655 missense probably damaging 1.00
R0288:Rsbn1l UTSW 5 20920040 missense probably damaging 0.97
R1429:Rsbn1l UTSW 5 20920018 missense probably damaging 1.00
R1524:Rsbn1l UTSW 5 20951673 missense probably damaging 1.00
R1713:Rsbn1l UTSW 5 20951490 missense probably benign 0.18
R1875:Rsbn1l UTSW 5 20951698 missense probably benign 0.17
R1998:Rsbn1l UTSW 5 20902370 missense probably damaging 1.00
R1999:Rsbn1l UTSW 5 20902370 missense probably damaging 1.00
R2000:Rsbn1l UTSW 5 20902370 missense probably damaging 1.00
R2504:Rsbn1l UTSW 5 20902366 missense probably damaging 1.00
R2566:Rsbn1l UTSW 5 20919769 missense probably benign 0.40
R3434:Rsbn1l UTSW 5 20905930 splice site probably benign
R3893:Rsbn1l UTSW 5 20905840 missense probably damaging 1.00
R3924:Rsbn1l UTSW 5 20919787 missense probably damaging 1.00
R4335:Rsbn1l UTSW 5 20908193 missense probably null 0.45
R4422:Rsbn1l UTSW 5 20896546 missense probably damaging 1.00
R5131:Rsbn1l UTSW 5 20896245 missense possibly damaging 0.89
R5212:Rsbn1l UTSW 5 20896214 missense probably benign 0.03
R5739:Rsbn1l UTSW 5 20905816 missense probably damaging 1.00
R6736:Rsbn1l UTSW 5 20908224 missense probably benign 0.45
R6980:Rsbn1l UTSW 5 20896484 missense probably benign
R7252:Rsbn1l UTSW 5 20908198 missense probably damaging 1.00
R7443:Rsbn1l UTSW 5 20927623 missense possibly damaging 0.61
R7538:Rsbn1l UTSW 5 20896457 missense probably benign 0.01
R7914:Rsbn1l UTSW 5 20905898 missense probably damaging 1.00
R8396:Rsbn1l UTSW 5 20927667 missense probably benign 0.40
R8899:Rsbn1l UTSW 5 20896867 missense probably damaging 1.00
R8941:Rsbn1l UTSW 5 20905843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAGGAATGTGACAACGC -3'
(R):5'- CTGGTGCAGCTCTAAGAATCAAG -3'

Sequencing Primer
(F):5'- CTGAGGAATGTGACAACGCTACATC -3'
(R):5'- GGATGGCTCCCATACCTGAAAAG -3'
Posted On 2015-03-25