Incidental Mutation 'R3789:Prmt8'
ID272435
Institutional Source Beutler Lab
Gene Symbol Prmt8
Ensembl Gene ENSMUSG00000030350
Gene Nameprotein arginine N-methyltransferase 8
SynonymsHrmt1l3, Hrmt1l4
MMRRC Submission 041604-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3789 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location127689011-127769472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127711147 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 236 (I236N)
Ref Sequence ENSEMBL: ENSMUSP00000032500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032500]
Predicted Effect probably damaging
Transcript: ENSMUST00000032500
AA Change: I236N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032500
Gene: ENSMUSG00000030350
AA Change: I236N

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:PRMT5 80 368 4.5e-7 PFAM
Pfam:PrmA 102 200 2e-10 PFAM
Pfam:Methyltransf_31 110 274 7.3e-9 PFAM
Pfam:Methyltransf_18 111 215 9.9e-8 PFAM
Pfam:Methyltransf_11 116 215 6.2e-8 PFAM
Meta Mutation Damage Score 0.8778 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginine methylation is a widespread posttranslational modification mediated by arginine methyltransferases, such as PRMT8. Arginine methylation is involved in a number of cellular processes, including DNA repair, RNA transcription, signal transduction, protein compartmentalization, and possibly protein translation (Lee et al., 2005 [PubMed 16051612]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit abnormal Purkinje cell dendrite morphology, hyperactivity, limb grasping and gait abnormalities, and show reduced levels of acetylcholine and choline along with increased phosphatidylcholine levels in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C A 2: 148,847,958 E92* probably null Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Acvrl1 C T 15: 101,137,469 T292M probably damaging Het
Adamts8 T C 9: 30,959,292 S688P probably damaging Het
Adprhl2 A T 4: 126,316,751 I312N probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Clca4a C A 3: 144,974,956 G20V probably damaging Het
Col12a1 C A 9: 79,639,723 V2276L possibly damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dysf G A 6: 84,186,509 probably null Het
Ebf2 T A 14: 67,239,493 probably null Het
Emc8 T C 8: 120,658,130 T195A probably benign Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Frs3 G A 17: 47,699,696 probably null Het
Fsip2 T C 2: 82,982,714 S640P probably damaging Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hivep3 T C 4: 120,098,416 S1310P probably damaging Het
Hltf C T 3: 20,069,047 P200S probably damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lrp1 T C 10: 127,571,969 D1817G possibly damaging Het
Lrpprc T C 17: 84,771,528 I253V probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
Mcm9 G A 10: 53,616,017 R403W probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Olfr663 T A 7: 104,703,949 D127E probably damaging Het
Pclo A G 5: 14,680,450 probably benign Het
Plekha7 A C 7: 116,175,734 I175R probably damaging Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Rexo2 A G 9: 48,473,062 I139T probably damaging Het
Rsbn1l A C 5: 20,896,108 S811R probably benign Het
Sec24b T C 3: 130,020,627 D345G probably benign Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Snx33 T C 9: 56,918,560 E539G probably benign Het
Sorcs3 A G 19: 48,398,711 T212A possibly damaging Het
Spa17 T G 9: 37,611,845 K49Q possibly damaging Het
St3gal6 C T 16: 58,484,773 E109K probably benign Het
Stat4 A G 1: 52,011,796 N5D probably benign Het
Tmem232 C T 17: 65,382,525 D532N probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tmem81 A G 1: 132,508,071 N205S probably benign Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r23 A T 6: 123,741,389 N567I probably damaging Het
Other mutations in Prmt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02122:Prmt8 APN 6 127690717 missense probably benign 0.17
IGL02178:Prmt8 APN 6 127697807 missense probably benign 0.06
IGL02526:Prmt8 APN 6 127711823 missense probably damaging 0.96
IGL03010:Prmt8 APN 6 127729535 missense probably benign 0.09
IGL03037:Prmt8 APN 6 127703977 missense possibly damaging 0.75
R0096:Prmt8 UTSW 6 127732627 splice site probably benign
R0254:Prmt8 UTSW 6 127711808 missense probably damaging 1.00
R0355:Prmt8 UTSW 6 127711874 nonsense probably null
R0925:Prmt8 UTSW 6 127697813 missense probably benign 0.00
R1606:Prmt8 UTSW 6 127689836 nonsense probably null
R1716:Prmt8 UTSW 6 127726523 critical splice donor site probably null
R3790:Prmt8 UTSW 6 127711147 missense probably damaging 1.00
R3958:Prmt8 UTSW 6 127732744 missense probably benign 0.00
R5022:Prmt8 UTSW 6 127711163 missense possibly damaging 0.92
R5143:Prmt8 UTSW 6 127732714 missense probably benign
R5635:Prmt8 UTSW 6 127768729 missense probably damaging 1.00
R5816:Prmt8 UTSW 6 127697738 missense probably benign 0.09
R5959:Prmt8 UTSW 6 127729418 missense probably damaging 1.00
R6267:Prmt8 UTSW 6 127711804 missense probably damaging 0.99
R6296:Prmt8 UTSW 6 127711804 missense probably damaging 0.99
R6450:Prmt8 UTSW 6 127732643 missense possibly damaging 0.71
R6603:Prmt8 UTSW 6 127729413 missense probably benign 0.00
R7208:Prmt8 UTSW 6 127689829 missense possibly damaging 0.81
R7629:Prmt8 UTSW 6 127689883 nonsense probably null
R7719:Prmt8 UTSW 6 127729503 missense probably damaging 0.97
R8313:Prmt8 UTSW 6 127689850 missense probably benign
R8346:Prmt8 UTSW 6 127711847 missense probably damaging 1.00
R8404:Prmt8 UTSW 6 127689862 missense possibly damaging 0.93
R8483:Prmt8 UTSW 6 127704013 splice site probably null
R8843:Prmt8 UTSW 6 127729499 missense probably damaging 0.99
X0020:Prmt8 UTSW 6 127697771 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACCAGCCACATTGTTTATGCAC -3'
(R):5'- ACTGAGTGAGAAATGCTGGC -3'

Sequencing Primer
(F):5'- TATGCACTCTGTAGAGCTCCAAC -3'
(R):5'- TGGCAAGGGGGTGCTCATC -3'
Posted On2015-03-25