Incidental Mutation 'R3789:Spa17'
ID272440
Institutional Source Beutler Lab
Gene Symbol Spa17
Ensembl Gene ENSMUSG00000001948
Gene Namesperm autoantigenic protein 17
SynonymsSp17, band 34
MMRRC Submission 041604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3789 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location37603290-37613722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37611845 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 49 (K49Q)
Ref Sequence ENSEMBL: ENSMUSP00000002013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002013] [ENSMUST00000213126] [ENSMUST00000214786] [ENSMUST00000215474] [ENSMUST00000215829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002013
AA Change: K49Q

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002013
Gene: ENSMUSG00000001948
AA Change: K49Q

DomainStartEndE-ValueType
RIIa 14 51 7.04e-15 SMART
low complexity region 75 86 N/A INTRINSIC
IQ 111 133 7.4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213126
Predicted Effect probably benign
Transcript: ENSMUST00000214786
AA Change: K49Q

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215336
Predicted Effect probably benign
Transcript: ENSMUST00000215474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215678
Predicted Effect probably benign
Transcript: ENSMUST00000215829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217567
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein present at the cell surface. The N-terminus has sequence similarity to human cAMP-dependent protein kinase A (PKA) type II alpha regulatory subunit (RIIa) while the C-terminus has an IQ calmodulin-binding motif. The central portion of the protein has carbohydrate binding motifs and likely functions in cell-cell adhesion. The protein was initially characterized by its involvement in the binding of sperm to the zona pellucida of the oocyte. Recent studies indicate that it is also involved in additional cell-cell adhesion functions such as immune cell migration and metastasis. A retrotransposed pseudogene is present on chromosome 10q22.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C A 2: 148,847,958 E92* probably null Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Acvrl1 C T 15: 101,137,469 T292M probably damaging Het
Adamts8 T C 9: 30,959,292 S688P probably damaging Het
Adprhl2 A T 4: 126,316,751 I312N probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Clca4a C A 3: 144,974,956 G20V probably damaging Het
Col12a1 C A 9: 79,639,723 V2276L possibly damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dysf G A 6: 84,186,509 probably null Het
Ebf2 T A 14: 67,239,493 probably null Het
Emc8 T C 8: 120,658,130 T195A probably benign Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Frs3 G A 17: 47,699,696 probably null Het
Fsip2 T C 2: 82,982,714 S640P probably damaging Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hivep3 T C 4: 120,098,416 S1310P probably damaging Het
Hltf C T 3: 20,069,047 P200S probably damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lrp1 T C 10: 127,571,969 D1817G possibly damaging Het
Lrpprc T C 17: 84,771,528 I253V probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
Mcm9 G A 10: 53,616,017 R403W probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Olfr663 T A 7: 104,703,949 D127E probably damaging Het
Pclo A G 5: 14,680,450 probably benign Het
Plekha7 A C 7: 116,175,734 I175R probably damaging Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Rexo2 A G 9: 48,473,062 I139T probably damaging Het
Rsbn1l A C 5: 20,896,108 S811R probably benign Het
Sec24b T C 3: 130,020,627 D345G probably benign Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Snx33 T C 9: 56,918,560 E539G probably benign Het
Sorcs3 A G 19: 48,398,711 T212A possibly damaging Het
St3gal6 C T 16: 58,484,773 E109K probably benign Het
Stat4 A G 1: 52,011,796 N5D probably benign Het
Tmem232 C T 17: 65,382,525 D532N probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tmem81 A G 1: 132,508,071 N205S probably benign Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r23 A T 6: 123,741,389 N567I probably damaging Het
Other mutations in Spa17
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0575:Spa17 UTSW 9 37603393 missense probably damaging 0.99
R5244:Spa17 UTSW 9 37611989 start codon destroyed probably damaging 1.00
R5503:Spa17 UTSW 9 37611977 missense probably damaging 1.00
R6612:Spa17 UTSW 9 37605794 missense probably benign 0.14
R6636:Spa17 UTSW 9 37611974 missense probably benign 0.45
R6637:Spa17 UTSW 9 37611974 missense probably benign 0.45
R7233:Spa17 UTSW 9 37603291 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGGCTTTCTGCACAATGACC -3'
(R):5'- ACCATATAGGCAATTCTTTCCGAG -3'

Sequencing Primer
(F):5'- CTGCACAATGACCATGATTTTTAATG -3'
(R):5'- TCCGAGGAGATGTCGATTCC -3'
Posted On2015-03-25