Mutagenetix > Incidental Mutations

Incidental Mutation 'R3789:Snx33'

272442

Institutional Source

Beutler Lab

Gene Symbol

Snx33

Ensembl Gene

ENSMUSG00000032733

Gene Name

sorting nexin 33

Synonyms

Sh3px3, E130307J07Rik

MMRRC Submission

041604-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R3789 (G1)

Quality Score

147

Status

Not validated

Chromosome

Chromosomal Location

56917193-56928371 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56918560 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 539 (E539G)

Ref Sequence

ENSEMBL: ENSMUSP00000060225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050916]

Predicted Effect

probably benign
Transcript: ENSMUST00000050916
AA Change: E539G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000060225
Gene: ENSMUSG00000032733
AA Change: E539G

Domain	Start	End	E-Value	Type
SH3	3	60	3.2e-15	SMART
low complexity region	111	122	N/A	INTRINSIC
PX	227	336	6.69e-18	SMART
Pfam:BAR_3_WASP_bdg	337	572	1.1e-113	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cytoskeletal reorganization, vesicle trafficking, endocytosis, and mitosis. The encoded protein is essential for the creation of the cleavage furrow during mitosis and for completion of mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230104L09Rik	C	A	2: 148,847,958	E92*	probably null	Het
Abca13	T	A	11: 9,510,668	I4226N	probably damaging	Het
Abhd16a	A	G	17: 35,101,587	N411S	probably damaging	Het
Acvrl1	C	T	15: 101,137,469	T292M	probably damaging	Het
Adamts8	T	C	9: 30,959,292	S688P	probably damaging	Het
Adprhl2	A	T	4: 126,316,751	I312N	probably damaging	Het
Bclaf3	A	G	X: 159,566,496	H619R	probably benign	Het
Clca4a	C	A	3: 144,974,956	G20V	probably damaging	Het
Col12a1	C	A	9: 79,639,723	V2276L	possibly damaging	Het
Drosha	T	A	15: 12,912,537	Y1080*	probably null	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Ebf2	T	A	14: 67,239,493		probably null	Het
Emc8	T	C	8: 120,658,130	T195A	probably benign	Het
Fam60a	A	G	6: 148,926,119	S134P	possibly damaging	Het
Frs3	G	A	17: 47,699,696		probably null	Het
Fsip2	T	C	2: 82,982,714	S640P	probably damaging	Het
Hdhd2	G	A	18: 76,955,187		probably null	Het
Hivep3	T	C	4: 120,098,416	S1310P	probably damaging	Het
Hltf	C	T	3: 20,069,047	P200S	probably damaging	Het
Lnpk	A	T	2: 74,522,263	S358R	probably benign	Het
Lrp1	T	C	10: 127,571,969	D1817G	possibly damaging	Het
Lrpprc	T	C	17: 84,771,528	I253V	probably benign	Het
Map2	A	G	1: 66,416,863	T1512A	probably damaging	Het
Mcm9	G	A	10: 53,616,017	R403W	probably damaging	Het
Mms22l	A	G	4: 24,517,115	D222G	possibly damaging	Het
Mug1	G	A	6: 121,884,628	V1350I	probably benign	Het
Olfr663	T	A	7: 104,703,949	D127E	probably damaging	Het
Pclo	A	G	5: 14,680,450		probably benign	Het
Plekha7	A	C	7: 116,175,734	I175R	probably damaging	Het
Plxnb1	T	A	9: 109,109,287	V1303D	possibly damaging	Het
Pou2f1	G	C	1: 165,894,969	P349R	probably damaging	Het
Prmt8	A	T	6: 127,711,147	I236N	probably damaging	Het
Rexo2	A	G	9: 48,473,062	I139T	probably damaging	Het
Rsbn1l	A	C	5: 20,896,108	S811R	probably benign	Het
Sec24b	T	C	3: 130,020,627	D345G	probably benign	Het
Serpina1b	A	G	12: 103,729,272	S337P	probably damaging	Het
Sorcs3	A	G	19: 48,398,711	T212A	possibly damaging	Het
Spa17	T	G	9: 37,611,845	K49Q	possibly damaging	Het
St3gal6	C	T	16: 58,484,773	E109K	probably benign	Het
Stat4	A	G	1: 52,011,796	N5D	probably benign	Het
Tmem232	C	T	17: 65,382,525	D532N	probably benign	Het
Tmem232	C	A	17: 65,382,633	D496Y	possibly damaging	Het
Tmem81	A	G	1: 132,508,071	N205S	probably benign	Het
Tomm20l	C	T	12: 71,111,742	A58V	possibly damaging	Het
Ttn	A	G	2: 76,974,208	V240A	probably benign	Het
Vmn2r23	A	T	6: 123,741,389	N567I	probably damaging	Het

Other mutations in Snx33

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02261:Snx33	APN	9	56926578	missense	probably benign
IGL02646:Snx33	APN	9	56926759	missense	probably damaging	1.00
IGL03028:Snx33	APN	9	56926451	missense	probably benign
R0206:Snx33	UTSW	9	56926224	missense	probably damaging	1.00
R0755:Snx33	UTSW	9	56925457	missense	possibly damaging	0.84
R1218:Snx33	UTSW	9	56925985	missense	probably damaging	1.00
R1523:Snx33	UTSW	9	56926182	missense	possibly damaging	0.47
R1627:Snx33	UTSW	9	56925957	missense	probably damaging	1.00
R1758:Snx33	UTSW	9	56926698	missense	probably benign	0.29
R1856:Snx33	UTSW	9	56926011	missense	possibly damaging	0.85
R1885:Snx33	UTSW	9	56925837	missense	probably benign	0.42
R2113:Snx33	UTSW	9	56926440	missense	probably benign	0.28
R2422:Snx33	UTSW	9	56918538	missense	probably benign	0.03
R3870:Snx33	UTSW	9	56926740	missense	probably benign	0.05
R3871:Snx33	UTSW	9	56926740	missense	probably benign	0.05
R4734:Snx33	UTSW	9	56925901	missense	possibly damaging	0.84
R4884:Snx33	UTSW	9	56926180	missense	probably damaging	0.99
R5069:Snx33	UTSW	9	56926191	missense	probably damaging	0.97
R5555:Snx33	UTSW	9	56925397	missense	probably benign
R6153:Snx33	UTSW	9	56926699	missense	possibly damaging	0.74
R7178:Snx33	UTSW	9	56925867	missense	probably damaging	1.00
R7179:Snx33	UTSW	9	56925867	missense	probably damaging	1.00
R7315:Snx33	UTSW	9	56925867	missense	probably damaging	1.00
R7414:Snx33	UTSW	9	56925867	missense	probably damaging	1.00
R7593:Snx33	UTSW	9	56926774	missense	possibly damaging	0.52
R7607:Snx33	UTSW	9	56926713	missense	probably benign
R7632:Snx33	UTSW	9	56926418	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCCACTGCTAATGACAGGAG -3'
(R):5'- AATACGCCTGTCATTCACCCTG -3'

Sequencing Primer
(F):5'- CTGCTAATGACAGGAGTGGAATAGAC -3'
(R):5'- GGAGATACAAGCCCTGACCTG -3'

Posted On

2015-03-25