Incidental Mutation 'R3789:Snx33'
ID272442
Institutional Source Beutler Lab
Gene Symbol Snx33
Ensembl Gene ENSMUSG00000032733
Gene Namesorting nexin 33
SynonymsSh3px3, E130307J07Rik
MMRRC Submission 041604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3789 (G1)
Quality Score147
Status Not validated
Chromosome9
Chromosomal Location56917193-56928371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56918560 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 539 (E539G)
Ref Sequence ENSEMBL: ENSMUSP00000060225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050916]
Predicted Effect probably benign
Transcript: ENSMUST00000050916
AA Change: E539G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000060225
Gene: ENSMUSG00000032733
AA Change: E539G

DomainStartEndE-ValueType
SH3 3 60 3.2e-15 SMART
low complexity region 111 122 N/A INTRINSIC
PX 227 336 6.69e-18 SMART
Pfam:BAR_3_WASP_bdg 337 572 1.1e-113 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cytoskeletal reorganization, vesicle trafficking, endocytosis, and mitosis. The encoded protein is essential for the creation of the cleavage furrow during mitosis and for completion of mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C A 2: 148,847,958 E92* probably null Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Acvrl1 C T 15: 101,137,469 T292M probably damaging Het
Adamts8 T C 9: 30,959,292 S688P probably damaging Het
Adprhl2 A T 4: 126,316,751 I312N probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Clca4a C A 3: 144,974,956 G20V probably damaging Het
Col12a1 C A 9: 79,639,723 V2276L possibly damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dysf G A 6: 84,186,509 probably null Het
Ebf2 T A 14: 67,239,493 probably null Het
Emc8 T C 8: 120,658,130 T195A probably benign Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Frs3 G A 17: 47,699,696 probably null Het
Fsip2 T C 2: 82,982,714 S640P probably damaging Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hivep3 T C 4: 120,098,416 S1310P probably damaging Het
Hltf C T 3: 20,069,047 P200S probably damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lrp1 T C 10: 127,571,969 D1817G possibly damaging Het
Lrpprc T C 17: 84,771,528 I253V probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
Mcm9 G A 10: 53,616,017 R403W probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Olfr663 T A 7: 104,703,949 D127E probably damaging Het
Pclo A G 5: 14,680,450 probably benign Het
Plekha7 A C 7: 116,175,734 I175R probably damaging Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Rexo2 A G 9: 48,473,062 I139T probably damaging Het
Rsbn1l A C 5: 20,896,108 S811R probably benign Het
Sec24b T C 3: 130,020,627 D345G probably benign Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Sorcs3 A G 19: 48,398,711 T212A possibly damaging Het
Spa17 T G 9: 37,611,845 K49Q possibly damaging Het
St3gal6 C T 16: 58,484,773 E109K probably benign Het
Stat4 A G 1: 52,011,796 N5D probably benign Het
Tmem232 C T 17: 65,382,525 D532N probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tmem81 A G 1: 132,508,071 N205S probably benign Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r23 A T 6: 123,741,389 N567I probably damaging Het
Other mutations in Snx33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Snx33 APN 9 56926578 missense probably benign
IGL02646:Snx33 APN 9 56926759 missense probably damaging 1.00
IGL03028:Snx33 APN 9 56926451 missense probably benign
R0206:Snx33 UTSW 9 56926224 missense probably damaging 1.00
R0755:Snx33 UTSW 9 56925457 missense possibly damaging 0.84
R1218:Snx33 UTSW 9 56925985 missense probably damaging 1.00
R1523:Snx33 UTSW 9 56926182 missense possibly damaging 0.47
R1627:Snx33 UTSW 9 56925957 missense probably damaging 1.00
R1758:Snx33 UTSW 9 56926698 missense probably benign 0.29
R1856:Snx33 UTSW 9 56926011 missense possibly damaging 0.85
R1885:Snx33 UTSW 9 56925837 missense probably benign 0.42
R2113:Snx33 UTSW 9 56926440 missense probably benign 0.28
R2422:Snx33 UTSW 9 56918538 missense probably benign 0.03
R3870:Snx33 UTSW 9 56926740 missense probably benign 0.05
R3871:Snx33 UTSW 9 56926740 missense probably benign 0.05
R4734:Snx33 UTSW 9 56925901 missense possibly damaging 0.84
R4884:Snx33 UTSW 9 56926180 missense probably damaging 0.99
R5069:Snx33 UTSW 9 56926191 missense probably damaging 0.97
R5555:Snx33 UTSW 9 56925397 missense probably benign
R6153:Snx33 UTSW 9 56926699 missense possibly damaging 0.74
R7178:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7179:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7315:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7414:Snx33 UTSW 9 56925867 missense probably damaging 1.00
R7593:Snx33 UTSW 9 56926774 missense possibly damaging 0.52
R7607:Snx33 UTSW 9 56926713 missense probably benign
R7632:Snx33 UTSW 9 56926418 missense probably damaging 0.98
R8022:Snx33 UTSW 9 56925340 missense possibly damaging 0.65
R8460:Snx33 UTSW 9 56926192 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCCACTGCTAATGACAGGAG -3'
(R):5'- AATACGCCTGTCATTCACCCTG -3'

Sequencing Primer
(F):5'- CTGCTAATGACAGGAGTGGAATAGAC -3'
(R):5'- GGAGATACAAGCCCTGACCTG -3'
Posted On2015-03-25