Incidental Mutation 'R3789:Ebf2'
ID272453
Institutional Source Beutler Lab
Gene Symbol Ebf2
Ensembl Gene ENSMUSG00000022053
Gene Nameearly B cell factor 2
SynonymsMmot1, D14Ggc1e, O/E-3
MMRRC Submission 041604-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R3789 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location67233292-67430918 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 67239493 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022637] [ENSMUST00000176029] [ENSMUST00000176161]
Predicted Effect probably null
Transcript: ENSMUST00000022637
SMART Domains Protein: ENSMUSP00000022637
Gene: ENSMUSG00000022053

DomainStartEndE-ValueType
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176029
SMART Domains Protein: ENSMUSP00000135782
Gene: ENSMUSG00000022053

DomainStartEndE-ValueType
Pfam:COE1_DBD 16 246 2.3e-145 PFAM
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176161
SMART Domains Protein: ENSMUSP00000135500
Gene: ENSMUSG00000022053

DomainStartEndE-ValueType
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177231
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the COE (Collier/Olf/EBF) family of non-basic, helix-loop-helix transcription factors that have a well conserved DNA binding domain. The COE family proteins play an important role in variety of developmental processes. Studies in mouse suggest that this gene may be involved in the differentiation of osteoblasts. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mutants show decreased viability, impaired olfactory neuron projection, and impaired mating, more so in male mice. Mice homozygous for another knock-out allele exhibit narcolepsy-cataplexy syndrome and decreased orexinergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C A 2: 148,847,958 E92* probably null Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Acvrl1 C T 15: 101,137,469 T292M probably damaging Het
Adamts8 T C 9: 30,959,292 S688P probably damaging Het
Adprhl2 A T 4: 126,316,751 I312N probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Clca4a C A 3: 144,974,956 G20V probably damaging Het
Col12a1 C A 9: 79,639,723 V2276L possibly damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dysf G A 6: 84,186,509 probably null Het
Emc8 T C 8: 120,658,130 T195A probably benign Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Frs3 G A 17: 47,699,696 probably null Het
Fsip2 T C 2: 82,982,714 S640P probably damaging Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hivep3 T C 4: 120,098,416 S1310P probably damaging Het
Hltf C T 3: 20,069,047 P200S probably damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lrp1 T C 10: 127,571,969 D1817G possibly damaging Het
Lrpprc T C 17: 84,771,528 I253V probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
Mcm9 G A 10: 53,616,017 R403W probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Olfr663 T A 7: 104,703,949 D127E probably damaging Het
Pclo A G 5: 14,680,450 probably benign Het
Plekha7 A C 7: 116,175,734 I175R probably damaging Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Rexo2 A G 9: 48,473,062 I139T probably damaging Het
Rsbn1l A C 5: 20,896,108 S811R probably benign Het
Sec24b T C 3: 130,020,627 D345G probably benign Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Snx33 T C 9: 56,918,560 E539G probably benign Het
Sorcs3 A G 19: 48,398,711 T212A possibly damaging Het
Spa17 T G 9: 37,611,845 K49Q possibly damaging Het
St3gal6 C T 16: 58,484,773 E109K probably benign Het
Stat4 A G 1: 52,011,796 N5D probably benign Het
Tmem232 C T 17: 65,382,525 D532N probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tmem81 A G 1: 132,508,071 N205S probably benign Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r23 A T 6: 123,741,389 N567I probably damaging Het
Other mutations in Ebf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Ebf2 APN 14 67239478 missense probably damaging 1.00
IGL01808:Ebf2 APN 14 67414483 missense probably benign 0.01
IGL02087:Ebf2 APN 14 67428096 missense probably benign 0.03
IGL02094:Ebf2 APN 14 67235240 missense possibly damaging 0.80
IGL02270:Ebf2 APN 14 67238953 missense probably damaging 1.00
IGL03222:Ebf2 APN 14 67411992 splice site probably null
IGL03390:Ebf2 APN 14 67424109 missense probably benign 0.19
G1Funyon:Ebf2 UTSW 14 67238982 missense possibly damaging 0.86
R0044:Ebf2 UTSW 14 67310968 intron probably benign
R0062:Ebf2 UTSW 14 67238540 splice site probably benign
R0062:Ebf2 UTSW 14 67238540 splice site probably benign
R0069:Ebf2 UTSW 14 67410050 missense probably damaging 0.99
R0069:Ebf2 UTSW 14 67410050 missense probably damaging 0.99
R0505:Ebf2 UTSW 14 67371736 nonsense probably null
R2103:Ebf2 UTSW 14 67387942 missense probably damaging 1.00
R2438:Ebf2 UTSW 14 67387942 missense probably damaging 1.00
R4153:Ebf2 UTSW 14 67235223 missense probably damaging 1.00
R4348:Ebf2 UTSW 14 67239422 missense probably damaging 0.99
R4793:Ebf2 UTSW 14 67410082 missense probably damaging 1.00
R4991:Ebf2 UTSW 14 67389657 missense possibly damaging 0.87
R5164:Ebf2 UTSW 14 67390521 missense possibly damaging 0.94
R5222:Ebf2 UTSW 14 67313594 intron probably benign
R5227:Ebf2 UTSW 14 67247069 missense probably damaging 0.99
R5459:Ebf2 UTSW 14 67235201 missense probably benign 0.34
R5622:Ebf2 UTSW 14 67390558 missense possibly damaging 0.91
R6035:Ebf2 UTSW 14 67238974 missense probably damaging 1.00
R6035:Ebf2 UTSW 14 67238974 missense probably damaging 1.00
R6265:Ebf2 UTSW 14 67424060 missense probably benign 0.00
R6893:Ebf2 UTSW 14 67237559 missense probably benign 0.22
R7078:Ebf2 UTSW 14 67423958 missense probably benign
R7394:Ebf2 UTSW 14 67237526 missense probably damaging 0.99
R7449:Ebf2 UTSW 14 67410020 missense probably damaging 0.99
R7652:Ebf2 UTSW 14 67390567 critical splice donor site probably null
R7724:Ebf2 UTSW 14 67424040 missense probably damaging 1.00
R8143:Ebf2 UTSW 14 67411937 nonsense probably null
R8153:Ebf2 UTSW 14 67390465 missense probably damaging 0.97
R8301:Ebf2 UTSW 14 67238982 missense possibly damaging 0.86
R8963:Ebf2 UTSW 14 67428105 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GGCTGTTTTAACCGAGCAAAG -3'
(R):5'- ATCCTGTGGAAGAAACTCTGGG -3'

Sequencing Primer
(F):5'- CTGTTTTAACCGAGCAAAGACTTTGG -3'
(R):5'- CCTGTGGAAGAAACTCTGGGAAGTC -3'
Posted On2015-03-25