Incidental Mutation 'R3789:St3gal6'
ID 272456
Institutional Source Beutler Lab
Gene Symbol St3gal6
Ensembl Gene ENSMUSG00000022747
Gene Name ST3 beta-galactoside alpha-2,3-sialyltransferase 6
Synonyms 1700023B24Rik, ST3Gal VI, Siat10
MMRRC Submission 041604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock # R3789 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 58468125-58524243 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 58484773 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 109 (E109K)
Ref Sequence ENSEMBL: ENSMUSP00000115756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114357] [ENSMUST00000114358] [ENSMUST00000126978] [ENSMUST00000137035] [ENSMUST00000149456]
AlphaFold Q8VIB3
Predicted Effect probably benign
Transcript: ENSMUST00000114357
AA Change: E109K

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109997
Gene: ENSMUSG00000022747
AA Change: E109K

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 63 329 6.2e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114358
AA Change: E109K

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109998
Gene: ENSMUSG00000022747
AA Change: E109K

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 71 329 7.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135721
Predicted Effect probably benign
Transcript: ENSMUST00000137035
AA Change: E109K

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115756
Gene: ENSMUSG00000022747
AA Change: E109K

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 63 329 6.2e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149197
Predicted Effect probably benign
Transcript: ENSMUST00000149456
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the sialyltransferase family. Members of this family are enzymes that transfer sialic acid from the activated cytidine 5'-monophospho-N-acetylneuraminic acid to terminal positions on sialylated glycolipids (gangliosides) or to the N- or O-linked sugar chains of glycoproteins. This protein has high specificity for neolactotetraosylceramide and neolactohexaosylceramide as glycolipid substrates and may contribute to the formation of selectin ligands and sialyl Lewis X, a carbohydrate important for cell-to-cell recognition and a blood group antigen. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit modest impairment in leukocyte rolling and neutrophil recruitment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C A 2: 148,847,958 E92* probably null Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Acvrl1 C T 15: 101,137,469 T292M probably damaging Het
Adamts8 T C 9: 30,959,292 S688P probably damaging Het
Adprhl2 A T 4: 126,316,751 I312N probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Clca4a C A 3: 144,974,956 G20V probably damaging Het
Col12a1 C A 9: 79,639,723 V2276L possibly damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dysf G A 6: 84,186,509 probably null Het
Ebf2 T A 14: 67,239,493 probably null Het
Emc8 T C 8: 120,658,130 T195A probably benign Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Frs3 G A 17: 47,699,696 probably null Het
Fsip2 T C 2: 82,982,714 S640P probably damaging Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hivep3 T C 4: 120,098,416 S1310P probably damaging Het
Hltf C T 3: 20,069,047 P200S probably damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lrp1 T C 10: 127,571,969 D1817G possibly damaging Het
Lrpprc T C 17: 84,771,528 I253V probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
Mcm9 G A 10: 53,616,017 R403W probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Olfr663 T A 7: 104,703,949 D127E probably damaging Het
Pclo A G 5: 14,680,450 probably benign Het
Plekha7 A C 7: 116,175,734 I175R probably damaging Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Rexo2 A G 9: 48,473,062 I139T probably damaging Het
Rsbn1l A C 5: 20,896,108 S811R probably benign Het
Sec24b T C 3: 130,020,627 D345G probably benign Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Snx33 T C 9: 56,918,560 E539G probably benign Het
Sorcs3 A G 19: 48,398,711 T212A possibly damaging Het
Spa17 T G 9: 37,611,845 K49Q possibly damaging Het
Stat4 A G 1: 52,011,796 N5D probably benign Het
Tmem232 C T 17: 65,382,525 D532N probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tmem81 A G 1: 132,508,071 N205S probably benign Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r23 A T 6: 123,741,389 N567I probably damaging Het
Other mutations in St3gal6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:St3gal6 APN 16 58484775 missense probably benign 0.31
IGL01583:St3gal6 APN 16 58493670 unclassified probably benign
IGL02512:St3gal6 APN 16 58473459 missense probably benign 0.00
R0212:St3gal6 UTSW 16 58473453 missense probably damaging 0.96
R0212:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R0441:St3gal6 UTSW 16 58473453 missense probably damaging 0.96
R0441:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R0442:St3gal6 UTSW 16 58473453 missense probably damaging 0.96
R0442:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R1786:St3gal6 UTSW 16 58475871 missense probably damaging 1.00
R1939:St3gal6 UTSW 16 58473561 splice site probably null
R2233:St3gal6 UTSW 16 58473534 missense probably damaging 1.00
R2274:St3gal6 UTSW 16 58488969 missense possibly damaging 0.46
R2336:St3gal6 UTSW 16 58493704 missense probably damaging 1.00
R2434:St3gal6 UTSW 16 58470652 missense probably damaging 1.00
R6318:St3gal6 UTSW 16 58486406 missense probably benign 0.01
R7320:St3gal6 UTSW 16 58493711 missense probably benign 0.00
R7599:St3gal6 UTSW 16 58473437 missense probably benign 0.00
R8907:St3gal6 UTSW 16 58493732 missense probably benign 0.00
R9100:St3gal6 UTSW 16 58486430 missense
Predicted Primers PCR Primer
(F):5'- CAAATCTCTGAGCCAGCCAGTG -3'
(R):5'- CTACTGATTAACTCCAGTGTGGC -3'

Sequencing Primer
(F):5'- AGTGCTGCAGCTCCTAAGTC -3'
(R):5'- ACTCCAGTGTGGCAATAGTAC -3'
Posted On 2015-03-25