Incidental Mutation 'R3789:Frs3'
ID 272458
Institutional Source Beutler Lab
Gene Symbol Frs3
Ensembl Gene ENSMUSG00000023266
Gene Name fibroblast growth factor receptor substrate 3
Synonyms 4930417B13Rik, SNT2, Frs2beta
MMRRC Submission 041604-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock # R3789 (G1)
Quality Score 221
Status Not validated
Chromosome 17
Chromosomal Location 47689030-47704286 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 47699696 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113296] [ENSMUST00000156118]
AlphaFold Q91WJ0
Predicted Effect probably null
Transcript: ENSMUST00000113296
SMART Domains Protein: ENSMUSP00000108921
Gene: ENSMUSG00000023266

DomainStartEndE-ValueType
IRS 17 110 4.31e-33 SMART
PTBI 18 110 1.23e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151540
Predicted Effect probably benign
Transcript: ENSMUST00000156118
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a substrate for the fibroblast growth factor receptor. The encoded protein is found in the peripheral plasma membrane and links fibroblast growth factor receptor stimulation to activators of Ras. The encoded protein down-regulates extracellular regulated kinase 2 through direct binding. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C A 2: 148,847,958 E92* probably null Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Acvrl1 C T 15: 101,137,469 T292M probably damaging Het
Adamts8 T C 9: 30,959,292 S688P probably damaging Het
Adprhl2 A T 4: 126,316,751 I312N probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Clca4a C A 3: 144,974,956 G20V probably damaging Het
Col12a1 C A 9: 79,639,723 V2276L possibly damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dysf G A 6: 84,186,509 probably null Het
Ebf2 T A 14: 67,239,493 probably null Het
Emc8 T C 8: 120,658,130 T195A probably benign Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Fsip2 T C 2: 82,982,714 S640P probably damaging Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hivep3 T C 4: 120,098,416 S1310P probably damaging Het
Hltf C T 3: 20,069,047 P200S probably damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lrp1 T C 10: 127,571,969 D1817G possibly damaging Het
Lrpprc T C 17: 84,771,528 I253V probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
Mcm9 G A 10: 53,616,017 R403W probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Olfr663 T A 7: 104,703,949 D127E probably damaging Het
Pclo A G 5: 14,680,450 probably benign Het
Plekha7 A C 7: 116,175,734 I175R probably damaging Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Rexo2 A G 9: 48,473,062 I139T probably damaging Het
Rsbn1l A C 5: 20,896,108 S811R probably benign Het
Sec24b T C 3: 130,020,627 D345G probably benign Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Snx33 T C 9: 56,918,560 E539G probably benign Het
Sorcs3 A G 19: 48,398,711 T212A possibly damaging Het
Spa17 T G 9: 37,611,845 K49Q possibly damaging Het
St3gal6 C T 16: 58,484,773 E109K probably benign Het
Stat4 A G 1: 52,011,796 N5D probably benign Het
Tmem232 C T 17: 65,382,525 D532N probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tmem81 A G 1: 132,508,071 N205S probably benign Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r23 A T 6: 123,741,389 N567I probably damaging Het
Other mutations in Frs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0310:Frs3 UTSW 17 47703822 missense probably benign
R0575:Frs3 UTSW 17 47703723 missense possibly damaging 0.89
R0638:Frs3 UTSW 17 47701656 missense probably benign 0.00
R1519:Frs3 UTSW 17 47702978 missense probably benign
R1668:Frs3 UTSW 17 47703222 missense possibly damaging 0.94
R2151:Frs3 UTSW 17 47703062 missense probably benign
R2517:Frs3 UTSW 17 47703072 missense probably benign 0.10
R3548:Frs3 UTSW 17 47703636 missense probably damaging 1.00
R3890:Frs3 UTSW 17 47703435 missense probably damaging 0.99
R4981:Frs3 UTSW 17 47689262 splice site probably null
R4996:Frs3 UTSW 17 47701710 missense probably damaging 1.00
R5479:Frs3 UTSW 17 47701710 missense probably damaging 1.00
R5944:Frs3 UTSW 17 47692308 intron probably benign
R5990:Frs3 UTSW 17 47701677 missense possibly damaging 0.81
R6102:Frs3 UTSW 17 47702671 missense probably damaging 1.00
R6151:Frs3 UTSW 17 47689088 start gained probably benign
R7219:Frs3 UTSW 17 47702695 missense probably damaging 1.00
R7359:Frs3 UTSW 17 47699525 missense probably damaging 0.98
R7404:Frs3 UTSW 17 47702726 critical splice donor site probably null
R7962:Frs3 UTSW 17 47699538 missense possibly damaging 0.95
R8021:Frs3 UTSW 17 47703114 missense probably damaging 1.00
R8337:Frs3 UTSW 17 47703852 missense probably damaging 1.00
R8407:Frs3 UTSW 17 47698627 missense probably damaging 1.00
R8976:Frs3 UTSW 17 47698621 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAGGTGACCAATGTGGATGATG -3'
(R):5'- AGCCTCTGATCCAAGAGCAC -3'

Sequencing Primer
(F):5'- TGACCAATGTGGATGATGAAGGG -3'
(R):5'- CATGGCCTGGAAGAACAGC -3'
Posted On 2015-03-25