Mutagenetix > Incidental Mutation

Incidental Mutation 'R3789:Lrpprc'

272461

Institutional Source

Beutler Lab

Gene Symbol

Lrpprc

Ensembl Gene

ENSMUSG00000024120

Gene Name

leucine-rich PPR-motif containing

Synonyms

3110001K13Rik, Lrp130

MMRRC Submission

041604-MU

Accession Numbers

Ncbi RefSeq: NM_028233.2; MGI:1919666

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3789 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84705247-84790789 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84771528 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 253 (I253V)

Ref Sequence

ENSEMBL: ENSMUSP00000107927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112308]

AlphaFold

Q6PB66

Predicted Effect

probably benign
Transcript: ENSMUST00000112308
AA Change: I253V

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: I253V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	32	50	N/A	INTRINSIC
low complexity region	123	136	N/A	INTRINSIC
Pfam:PPR_3	196	228	9.1e-4	PFAM
Pfam:PPR	197	227	2.3e-4	PFAM
Pfam:PPR_3	231	264	7.9e-6	PFAM
Pfam:PPR	232	262	4e-4	PFAM
Pfam:PPR_3	266	297	9.7e-3	PFAM
internal_repeat_2	391	477	3.13e-7	PROSPERO
Pfam:PPR	750	778	3.4e-4	PFAM
low complexity region	1017	1028	N/A	INTRINSIC
internal_repeat_1	1042	1362	1.09e-11	PROSPERO
low complexity region	1366	1375	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159222

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161299

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161928

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

Strain: 3857306; 5438913
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230104L09Rik	C	A	2: 148,847,958	E92*	probably null	Het
Abca13	T	A	11: 9,510,668	I4226N	probably damaging	Het
Abhd16a	A	G	17: 35,101,587	N411S	probably damaging	Het
Acvrl1	C	T	15: 101,137,469	T292M	probably damaging	Het
Adamts8	T	C	9: 30,959,292	S688P	probably damaging	Het
Adprhl2	A	T	4: 126,316,751	I312N	probably damaging	Het
Bclaf3	A	G	X: 159,566,496	H619R	probably benign	Het
Clca4a	C	A	3: 144,974,956	G20V	probably damaging	Het
Col12a1	C	A	9: 79,639,723	V2276L	possibly damaging	Het
Drosha	T	A	15: 12,912,537	Y1080*	probably null	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Ebf2	T	A	14: 67,239,493		probably null	Het
Emc8	T	C	8: 120,658,130	T195A	probably benign	Het
Fam60a	A	G	6: 148,926,119	S134P	possibly damaging	Het
Frs3	G	A	17: 47,699,696		probably null	Het
Fsip2	T	C	2: 82,982,714	S640P	probably damaging	Het
Hdhd2	G	A	18: 76,955,187		probably null	Het
Hivep3	T	C	4: 120,098,416	S1310P	probably damaging	Het
Hltf	C	T	3: 20,069,047	P200S	probably damaging	Het
Lnpk	A	T	2: 74,522,263	S358R	probably benign	Het
Lrp1	T	C	10: 127,571,969	D1817G	possibly damaging	Het
Map2	A	G	1: 66,416,863	T1512A	probably damaging	Het
Mcm9	G	A	10: 53,616,017	R403W	probably damaging	Het
Mms22l	A	G	4: 24,517,115	D222G	possibly damaging	Het
Mug1	G	A	6: 121,884,628	V1350I	probably benign	Het
Olfr663	T	A	7: 104,703,949	D127E	probably damaging	Het
Pclo	A	G	5: 14,680,450		probably benign	Het
Plekha7	A	C	7: 116,175,734	I175R	probably damaging	Het
Plxnb1	T	A	9: 109,109,287	V1303D	possibly damaging	Het
Pou2f1	G	C	1: 165,894,969	P349R	probably damaging	Het
Prmt8	A	T	6: 127,711,147	I236N	probably damaging	Het
Rexo2	A	G	9: 48,473,062	I139T	probably damaging	Het
Rsbn1l	A	C	5: 20,896,108	S811R	probably benign	Het
Sec24b	T	C	3: 130,020,627	D345G	probably benign	Het
Serpina1b	A	G	12: 103,729,272	S337P	probably damaging	Het
Snx33	T	C	9: 56,918,560	E539G	probably benign	Het
Sorcs3	A	G	19: 48,398,711	T212A	possibly damaging	Het
Spa17	T	G	9: 37,611,845	K49Q	possibly damaging	Het
St3gal6	C	T	16: 58,484,773	E109K	probably benign	Het
Stat4	A	G	1: 52,011,796	N5D	probably benign	Het
Tmem232	C	T	17: 65,382,525	D532N	probably benign	Het
Tmem232	C	A	17: 65,382,633	D496Y	possibly damaging	Het
Tmem81	A	G	1: 132,508,071	N205S	probably benign	Het
Tomm20l	C	T	12: 71,111,742	A58V	possibly damaging	Het
Ttn	A	G	2: 76,974,208	V240A	probably benign	Het
Vmn2r23	A	T	6: 123,741,389	N567I	probably damaging	Het

Other mutations in Lrpprc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Lrpprc	APN	17	84750525	missense	possibly damaging	0.91
IGL01319:Lrpprc	APN	17	84705412	utr 3 prime	probably benign
IGL01380:Lrpprc	APN	17	84722730	missense	probably benign
IGL01560:Lrpprc	APN	17	84708119	missense	probably benign	0.07
IGL01582:Lrpprc	APN	17	84754543	missense	probably null	0.00
IGL01996:Lrpprc	APN	17	84773270	missense	probably benign
IGL02109:Lrpprc	APN	17	84726570	nonsense	probably null
IGL02163:Lrpprc	APN	17	84753472	missense	probably damaging	0.97
IGL02248:Lrpprc	APN	17	84771467	missense	probably damaging	0.99
IGL02503:Lrpprc	APN	17	84726339	missense	probably benign
IGL02545:Lrpprc	APN	17	84775425	missense	probably benign
IGL02570:Lrpprc	APN	17	84750553	missense	probably damaging	1.00
IGL02636:Lrpprc	APN	17	84753104	unclassified	probably benign
IGL02943:Lrpprc	APN	17	84771450	missense	probably benign	0.00
IGL03008:Lrpprc	APN	17	84751247	missense	probably benign	0.05
elusory	UTSW	17	84712787	missense	probably benign	0.01
phantom	UTSW	17	84772147	missense	probably damaging	1.00
R6807_Lrpprc_629	UTSW	17	84749103	missense	possibly damaging	0.93
Stereotype	UTSW	17	84767055	missense	probably damaging	1.00
thus	UTSW	17	84770927	missense	probably benign	0.01
P0023:Lrpprc	UTSW	17	84726338	missense	probably benign	0.00
R0027:Lrpprc	UTSW	17	84767007	nonsense	probably null
R0027:Lrpprc	UTSW	17	84767007	nonsense	probably null
R0302:Lrpprc	UTSW	17	84740078	missense	possibly damaging	0.76
R0389:Lrpprc	UTSW	17	84753112	critical splice donor site	probably null
R0448:Lrpprc	UTSW	17	84770894	missense	probably benign	0.09
R1396:Lrpprc	UTSW	17	84726303	missense	possibly damaging	0.68
R1759:Lrpprc	UTSW	17	84740081	missense	probably damaging	1.00
R2019:Lrpprc	UTSW	17	84752331	missense	possibly damaging	0.56
R2169:Lrpprc	UTSW	17	84770077	missense	probably benign	0.00
R2312:Lrpprc	UTSW	17	84773258	missense	probably damaging	0.96
R2319:Lrpprc	UTSW	17	84726390	missense	probably benign
R2568:Lrpprc	UTSW	17	84726649	missense	probably damaging	1.00
R3013:Lrpprc	UTSW	17	84767069	missense	probably benign	0.04
R3620:Lrpprc	UTSW	17	84770024	missense	probably benign	0.01
R3848:Lrpprc	UTSW	17	84770927	missense	probably benign	0.01
R3973:Lrpprc	UTSW	17	84770841	critical splice donor site	probably null
R4111:Lrpprc	UTSW	17	84726338	missense	probably benign	0.00
R4164:Lrpprc	UTSW	17	84731189	missense	possibly damaging	0.47
R4331:Lrpprc	UTSW	17	84740542	critical splice donor site	probably null
R4531:Lrpprc	UTSW	17	84712787	missense	probably benign	0.01
R4832:Lrpprc	UTSW	17	84707156	missense	probably benign	0.24
R4947:Lrpprc	UTSW	17	84771538	missense	probably benign	0.02
R5134:Lrpprc	UTSW	17	84751256	missense	probably benign	0.00
R5333:Lrpprc	UTSW	17	84790393	missense	probably benign	0.01
R5950:Lrpprc	UTSW	17	84740170	missense	possibly damaging	0.86
R5972:Lrpprc	UTSW	17	84712822	missense	possibly damaging	0.88
R6185:Lrpprc	UTSW	17	84767024	missense	probably benign
R6253:Lrpprc	UTSW	17	84740637	missense	probably benign	0.00
R6488:Lrpprc	UTSW	17	84751353	missense	probably damaging	1.00
R6807:Lrpprc	UTSW	17	84749103	missense	possibly damaging	0.93
R6911:Lrpprc	UTSW	17	84756283	missense	possibly damaging	0.67
R6933:Lrpprc	UTSW	17	84722703	missense	probably benign	0.42
R6955:Lrpprc	UTSW	17	84776989	missense	probably damaging	0.98
R7448:Lrpprc	UTSW	17	84772139	missense	probably damaging	0.99
R7727:Lrpprc	UTSW	17	84776947	missense	probably benign	0.00
R8003:Lrpprc	UTSW	17	84752317	missense	probably benign	0.01
R8178:Lrpprc	UTSW	17	84772147	missense	probably damaging	1.00
R8310:Lrpprc	UTSW	17	84773096	missense	probably damaging	1.00
R8322:Lrpprc	UTSW	17	84740068	critical splice donor site	probably null
R8389:Lrpprc	UTSW	17	84773314	missense	possibly damaging	0.79
R8560:Lrpprc	UTSW	17	84740067	splice site	probably benign
R8777:Lrpprc	UTSW	17	84751229	missense	probably benign	0.30
R8777-TAIL:Lrpprc	UTSW	17	84751229	missense	probably benign	0.30
R8868:Lrpprc	UTSW	17	84771492	missense	probably damaging	0.99
R8970:Lrpprc	UTSW	17	84767055	missense	probably damaging	1.00
R9042:Lrpprc	UTSW	17	84752308	critical splice donor site	probably null
R9493:Lrpprc	UTSW	17	84708120	missense	probably damaging	0.99
R9664:Lrpprc	UTSW	17	84712834	missense	probably damaging	0.99
X0026:Lrpprc	UTSW	17	84710662	missense	probably benign	0.42
Z1088:Lrpprc	UTSW	17	84731784	nonsense	probably null
Z1088:Lrpprc	UTSW	17	84770500	critical splice acceptor site	probably null
Z1176:Lrpprc	UTSW	17	84770431	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- CTTTAAAACAGACGCAAGCTATGG -3'
(R):5'- TGCAGGTACTTACGAGAACATCTAG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- ACTTACGAGAACATCTAGTATTCCAG -3'

Posted On

2015-03-25