Incidental Mutation 'R3789:Hdhd2'
ID 272462
Institutional Source Beutler Lab
Gene Symbol Hdhd2
Ensembl Gene ENSMUSG00000025421
Gene Name haloacid dehalogenase-like hydrolase domain containing 2
Synonyms 0610039H12Rik, 3110052N05Rik
MMRRC Submission 041604-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3789 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 76930126-76972902 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 76955187 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026485] [ENSMUST00000097521] [ENSMUST00000097522] [ENSMUST00000142456] [ENSMUST00000143910] [ENSMUST00000145634] [ENSMUST00000145634] [ENSMUST00000147332] [ENSMUST00000147332] [ENSMUST00000148955] [ENSMUST00000148955] [ENSMUST00000150990] [ENSMUST00000150990] [ENSMUST00000156454]
AlphaFold Q3UGR5
PDB Structure Crystal Structure of Protein from Mouse Mm.236127 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000026485
SMART Domains Protein: ENSMUSP00000026485
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.1e-21 PFAM
Pfam:HAD_2 167 223 1e-7 PFAM
Pfam:Hydrolase_like 176 251 3.4e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000097521
SMART Domains Protein: ENSMUSP00000095128
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 123 4.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000097522
SMART Domains Protein: ENSMUSP00000095129
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142456
SMART Domains Protein: ENSMUSP00000118504
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Yos1 5 66 4.8e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143910
SMART Domains Protein: ENSMUSP00000118678
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 116 2.5e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000145634
SMART Domains Protein: ENSMUSP00000123320
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000145634
SMART Domains Protein: ENSMUSP00000123320
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147332
SMART Domains Protein: ENSMUSP00000116152
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 123 4.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147332
SMART Domains Protein: ENSMUSP00000116152
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 123 4.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148955
SMART Domains Protein: ENSMUSP00000116243
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148955
SMART Domains Protein: ENSMUSP00000116243
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000150990
SMART Domains Protein: ENSMUSP00000114212
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000150990
SMART Domains Protein: ENSMUSP00000114212
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156454
SMART Domains Protein: ENSMUSP00000123035
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 60 1.6e-13 PFAM
Meta Mutation Damage Score 0.9490 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transposon insertion results in complete embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C A 2: 148,847,958 E92* probably null Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Acvrl1 C T 15: 101,137,469 T292M probably damaging Het
Adamts8 T C 9: 30,959,292 S688P probably damaging Het
Adprhl2 A T 4: 126,316,751 I312N probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Clca4a C A 3: 144,974,956 G20V probably damaging Het
Col12a1 C A 9: 79,639,723 V2276L possibly damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dysf G A 6: 84,186,509 probably null Het
Ebf2 T A 14: 67,239,493 probably null Het
Emc8 T C 8: 120,658,130 T195A probably benign Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Frs3 G A 17: 47,699,696 probably null Het
Fsip2 T C 2: 82,982,714 S640P probably damaging Het
Hivep3 T C 4: 120,098,416 S1310P probably damaging Het
Hltf C T 3: 20,069,047 P200S probably damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lrp1 T C 10: 127,571,969 D1817G possibly damaging Het
Lrpprc T C 17: 84,771,528 I253V probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
Mcm9 G A 10: 53,616,017 R403W probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Olfr663 T A 7: 104,703,949 D127E probably damaging Het
Pclo A G 5: 14,680,450 probably benign Het
Plekha7 A C 7: 116,175,734 I175R probably damaging Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Rexo2 A G 9: 48,473,062 I139T probably damaging Het
Rsbn1l A C 5: 20,896,108 S811R probably benign Het
Sec24b T C 3: 130,020,627 D345G probably benign Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Snx33 T C 9: 56,918,560 E539G probably benign Het
Sorcs3 A G 19: 48,398,711 T212A possibly damaging Het
Spa17 T G 9: 37,611,845 K49Q possibly damaging Het
St3gal6 C T 16: 58,484,773 E109K probably benign Het
Stat4 A G 1: 52,011,796 N5D probably benign Het
Tmem232 C T 17: 65,382,525 D532N probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tmem81 A G 1: 132,508,071 N205S probably benign Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r23 A T 6: 123,741,389 N567I probably damaging Het
Other mutations in Hdhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Hdhd2 APN 18 76965273 splice site probably null
IGL01102:Hdhd2 APN 18 76956911 missense probably damaging 1.00
R0021:Hdhd2 UTSW 18 76970615 missense probably damaging 1.00
R0021:Hdhd2 UTSW 18 76970615 missense probably damaging 1.00
R0717:Hdhd2 UTSW 18 76951204 missense possibly damaging 0.94
R1958:Hdhd2 UTSW 18 76965145 missense probably benign
R2060:Hdhd2 UTSW 18 76965042 splice site probably null
R2266:Hdhd2 UTSW 18 76965170 missense probably benign 0.00
R2268:Hdhd2 UTSW 18 76965170 missense probably benign 0.00
R2269:Hdhd2 UTSW 18 76965170 missense probably benign 0.00
R2871:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2871:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2872:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2872:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R2873:Hdhd2 UTSW 18 76955006 missense probably damaging 1.00
R3788:Hdhd2 UTSW 18 76955187 critical splice donor site probably null
R5784:Hdhd2 UTSW 18 76967145 missense probably damaging 1.00
R7403:Hdhd2 UTSW 18 76955040 missense probably benign 0.00
R7406:Hdhd2 UTSW 18 76944115 missense probably benign 0.01
R7644:Hdhd2 UTSW 18 76944175 missense possibly damaging 0.79
R7849:Hdhd2 UTSW 18 76965266 missense probably damaging 1.00
R8992:Hdhd2 UTSW 18 76970670 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGCCACTTCTGTGATGGTTC -3'
(R):5'- GCAGCAACTAATGTGGTCGAG -3'

Sequencing Primer
(F):5'- GTTTGTGACCAATACAACCAAAGAG -3'
(R):5'- GCTGACCGACCAAGTGTTAG -3'
Posted On 2015-03-25