Mutagenetix > Incidental Mutations

Incidental Mutation 'R3789:Sorcs3'

272463

Institutional Source

Beutler Lab

Gene Symbol

Sorcs3

Ensembl Gene

ENSMUSG00000063434

Gene Name

sortilin-related VPS10 domain containing receptor 3

Synonyms

6330404A12Rik

MMRRC Submission

041604-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R3789 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

48206025-48805505 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 48398711 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 212 (T212A)

Ref Sequence

ENSEMBL: ENSMUSP00000077919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078880]

AlphaFold

Q8VI51

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078880
AA Change: T212A

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: T212A

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	46	63	N/A	INTRINSIC
low complexity region	69	91	N/A	INTRINSIC
VPS10	216	818	N/A	SMART
Pfam:PKD	823	901	8e-13	PFAM
transmembrane domain	1122	1141	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230104L09Rik	C	A	2: 148,847,958	E92*	probably null	Het
Abca13	T	A	11: 9,510,668	I4226N	probably damaging	Het
Abhd16a	A	G	17: 35,101,587	N411S	probably damaging	Het
Acvrl1	C	T	15: 101,137,469	T292M	probably damaging	Het
Adamts8	T	C	9: 30,959,292	S688P	probably damaging	Het
Adprhl2	A	T	4: 126,316,751	I312N	probably damaging	Het
Bclaf3	A	G	X: 159,566,496	H619R	probably benign	Het
Clca4a	C	A	3: 144,974,956	G20V	probably damaging	Het
Col12a1	C	A	9: 79,639,723	V2276L	possibly damaging	Het
Drosha	T	A	15: 12,912,537	Y1080*	probably null	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Ebf2	T	A	14: 67,239,493		probably null	Het
Emc8	T	C	8: 120,658,130	T195A	probably benign	Het
Fam60a	A	G	6: 148,926,119	S134P	possibly damaging	Het
Frs3	G	A	17: 47,699,696		probably null	Het
Fsip2	T	C	2: 82,982,714	S640P	probably damaging	Het
Hdhd2	G	A	18: 76,955,187		probably null	Het
Hivep3	T	C	4: 120,098,416	S1310P	probably damaging	Het
Hltf	C	T	3: 20,069,047	P200S	probably damaging	Het
Lnpk	A	T	2: 74,522,263	S358R	probably benign	Het
Lrp1	T	C	10: 127,571,969	D1817G	possibly damaging	Het
Lrpprc	T	C	17: 84,771,528	I253V	probably benign	Het
Map2	A	G	1: 66,416,863	T1512A	probably damaging	Het
Mcm9	G	A	10: 53,616,017	R403W	probably damaging	Het
Mms22l	A	G	4: 24,517,115	D222G	possibly damaging	Het
Mug1	G	A	6: 121,884,628	V1350I	probably benign	Het
Olfr663	T	A	7: 104,703,949	D127E	probably damaging	Het
Pclo	A	G	5: 14,680,450		probably benign	Het
Plekha7	A	C	7: 116,175,734	I175R	probably damaging	Het
Plxnb1	T	A	9: 109,109,287	V1303D	possibly damaging	Het
Pou2f1	G	C	1: 165,894,969	P349R	probably damaging	Het
Prmt8	A	T	6: 127,711,147	I236N	probably damaging	Het
Rexo2	A	G	9: 48,473,062	I139T	probably damaging	Het
Rsbn1l	A	C	5: 20,896,108	S811R	probably benign	Het
Sec24b	T	C	3: 130,020,627	D345G	probably benign	Het
Serpina1b	A	G	12: 103,729,272	S337P	probably damaging	Het
Snx33	T	C	9: 56,918,560	E539G	probably benign	Het
Spa17	T	G	9: 37,611,845	K49Q	possibly damaging	Het
St3gal6	C	T	16: 58,484,773	E109K	probably benign	Het
Stat4	A	G	1: 52,011,796	N5D	probably benign	Het
Tmem232	C	T	17: 65,382,525	D532N	probably benign	Het
Tmem232	C	A	17: 65,382,633	D496Y	possibly damaging	Het
Tmem81	A	G	1: 132,508,071	N205S	probably benign	Het
Tomm20l	C	T	12: 71,111,742	A58V	possibly damaging	Het
Ttn	A	G	2: 76,974,208	V240A	probably benign	Het
Vmn2r23	A	T	6: 123,741,389	N567I	probably damaging	Het

Other mutations in Sorcs3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sorcs3	APN	19	48683658	critical splice donor site	probably null
IGL00233:Sorcs3	APN	19	48748319	missense	probably benign	0.12
IGL00482:Sorcs3	APN	19	48603864	missense	probably benign	0.00
IGL00976:Sorcs3	APN	19	48767103	missense	probably damaging	1.00
IGL01367:Sorcs3	APN	19	48796375	missense	probably damaging	1.00
IGL01390:Sorcs3	APN	19	48790131	missense	probably damaging	1.00
IGL01548:Sorcs3	APN	19	48794168	missense	possibly damaging	0.87
IGL02162:Sorcs3	APN	19	48535531	missense	probably damaging	0.98
IGL02165:Sorcs3	APN	19	48654072	missense	probably benign	0.03
IGL02404:Sorcs3	APN	19	48704370	splice site	probably benign
IGL02830:Sorcs3	APN	19	48723002	splice site	probably null
IGL02943:Sorcs3	APN	19	48759938	missense	probably benign	0.00
R0371:Sorcs3	UTSW	19	48603894	missense	probably benign	0.00
R0456:Sorcs3	UTSW	19	48654044	missense	possibly damaging	0.94
R0466:Sorcs3	UTSW	19	48748319	missense	probably benign	0.12
R0470:Sorcs3	UTSW	19	48797517	critical splice donor site	probably null
R0536:Sorcs3	UTSW	19	48802698	nonsense	probably null
R0646:Sorcs3	UTSW	19	48206295	missense	probably benign	0.10
R0709:Sorcs3	UTSW	19	48487406	missense	probably benign
R0792:Sorcs3	UTSW	19	48706009	missense	possibly damaging	0.84
R0831:Sorcs3	UTSW	19	48693994	missense	probably damaging	1.00
R0836:Sorcs3	UTSW	19	48487394	missense	probably benign
R1253:Sorcs3	UTSW	19	48206736	missense	possibly damaging	0.67
R1390:Sorcs3	UTSW	19	48694001	critical splice donor site	probably null
R1522:Sorcs3	UTSW	19	48706009	missense	possibly damaging	0.84
R1570:Sorcs3	UTSW	19	48764181	missense	probably damaging	1.00
R1637:Sorcs3	UTSW	19	48748359	critical splice donor site	probably null
R1766:Sorcs3	UTSW	19	48603875	missense	possibly damaging	0.87
R1894:Sorcs3	UTSW	19	48794274	missense	probably benign	0.23
R2426:Sorcs3	UTSW	19	48722925	missense	probably damaging	1.00
R3818:Sorcs3	UTSW	19	48603904	missense	probably benign	0.00
R3824:Sorcs3	UTSW	19	48722956	missense	probably damaging	1.00
R3934:Sorcs3	UTSW	19	48713504	missense	probably damaging	1.00
R3936:Sorcs3	UTSW	19	48713504	missense	probably damaging	1.00
R4190:Sorcs3	UTSW	19	48749373	missense	possibly damaging	0.69
R4604:Sorcs3	UTSW	19	48693914	missense	probably benign	0.35
R4644:Sorcs3	UTSW	19	48683597	missense	probably damaging	1.00
R4774:Sorcs3	UTSW	19	48794163	missense	probably benign	0.23
R4801:Sorcs3	UTSW	19	48398744	missense	possibly damaging	0.46
R4802:Sorcs3	UTSW	19	48398744	missense	possibly damaging	0.46
R4945:Sorcs3	UTSW	19	48764148	missense	possibly damaging	0.50
R5049:Sorcs3	UTSW	19	48759951	missense	possibly damaging	0.93
R5175:Sorcs3	UTSW	19	48759845	critical splice acceptor site	probably null
R5342:Sorcs3	UTSW	19	48796472	splice site	probably null
R5848:Sorcs3	UTSW	19	48788511	missense	probably damaging	1.00
R5959:Sorcs3	UTSW	19	48749396	missense	probably damaging	1.00
R5977:Sorcs3	UTSW	19	48796450	missense	probably damaging	1.00
R6155:Sorcs3	UTSW	19	48398697	missense	possibly damaging	0.94
R6222:Sorcs3	UTSW	19	48759857	missense	possibly damaging	0.57
R6268:Sorcs3	UTSW	19	48790166	missense	probably damaging	1.00
R6416:Sorcs3	UTSW	19	48802759	missense	probably damaging	1.00
R6425:Sorcs3	UTSW	19	48764307	critical splice donor site	probably null
R6623:Sorcs3	UTSW	19	48788505	missense	probably benign	0.00
R6767:Sorcs3	UTSW	19	48713571	missense	probably damaging	0.99
R6888:Sorcs3	UTSW	19	48693824	missense	possibly damaging	0.83
R6955:Sorcs3	UTSW	19	48749343	missense	possibly damaging	0.82
R7106:Sorcs3	UTSW	19	48705963	missense	probably damaging	1.00
R7379:Sorcs3	UTSW	19	48772266	missense	possibly damaging	0.69
R7953:Sorcs3	UTSW	19	48764295	missense	possibly damaging	0.84
R8043:Sorcs3	UTSW	19	48764295	missense	possibly damaging	0.84
R8242:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8343:Sorcs3	UTSW	19	48704369	splice site	probably null
R8433:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8435:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8436:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8940:Sorcs3	UTSW	19	48796469	critical splice donor site	probably null
R8956:Sorcs3	UTSW	19	48749371	nonsense	probably null
R9051:Sorcs3	UTSW	19	48206370	missense	probably benign
R9119:Sorcs3	UTSW	19	48653994	missense	possibly damaging	0.92
R9166:Sorcs3	UTSW	19	48796372	missense	probably benign	0.01
R9328:Sorcs3	UTSW	19	48797511	missense	probably damaging	1.00
X0018:Sorcs3	UTSW	19	48772289	missense	probably damaging	1.00
Z1176:Sorcs3	UTSW	19	48645804	missense	probably damaging	1.00
Z1177:Sorcs3	UTSW	19	48704300	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAATGCAAAGCACTGTCAGG -3'
(R):5'- TGCACTGGAGAGACAAGTTC -3'

Sequencing Primer
(F):5'- GCACTGTCAGGATTAAAATAAATGC -3'
(R):5'- CACTGGAGAGACAAGTTCTAGATTTC -3'

Posted On

2015-03-25