Mutagenetix > Incidental Mutations

Incidental Mutation 'R3790:Lepr'

272481

Institutional Source

Beutler Lab

Gene Symbol

Lepr

Ensembl Gene

ENSMUSG00000057722

Gene Name

leptin receptor

Synonyms

obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3790 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101717404-101815352 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 101790914 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000102534 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]

Predicted Effect

probably benign
Transcript: ENSMUST00000037552

SMART Domains

Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	328	418	6.3e-23	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC
low complexity region	908	921	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102777

SMART Domains

Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106921

SMART Domains

Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151733

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acat3	G	A	17: 12,928,573	Q186*	probably null	Het
Alk	A	G	17: 72,603,432	L93P	possibly damaging	Het
Ankrd24	C	T	10: 81,642,679		probably benign	Het
Anks6	A	T	4: 47,049,212	V231E	probably damaging	Het
Ap5z1	C	T	5: 142,470,413	S329L	probably benign	Het
Asic4	C	A	1: 75,469,841		probably benign	Het
Cers4	C	A	8: 4,518,285	Q113K	possibly damaging	Het
Ces3b	A	T	8: 105,086,888	I264F	possibly damaging	Het
Cops3	T	C	11: 59,827,971	M166V	probably benign	Het
Corin	T	C	5: 72,435,298	Q184R	probably benign	Het
Dnah8	G	A	17: 30,854,898	R4514H	probably damaging	Het
Drosha	T	A	15: 12,912,537	Y1080*	probably null	Het
Gm53	T	C	11: 96,251,651		noncoding transcript	Het
Hmcn1	A	G	1: 150,622,994	S4045P	probably benign	Het
Kif22	A	G	7: 127,029,496	L480P	probably damaging	Het
Lnpk	A	T	2: 74,522,263	S358R	probably benign	Het
Lnx1	A	G	5: 74,628,366		probably benign	Het
Lrsam1	T	C	2: 32,958,159	E43G	probably null	Het
Mug1	G	A	6: 121,884,628	V1350I	probably benign	Het
Nbea	T	A	3: 56,005,029	E1112D	probably benign	Het
Nepn	T	A	10: 52,400,530	L60I	probably damaging	Het
Oas1e	T	C	5: 120,795,410	E30G	probably damaging	Het
Olfr1228	A	G	2: 89,248,993	F234L	probably benign	Het
Olfr729	A	C	14: 50,148,569	F102V	possibly damaging	Het
Pou2f1	G	C	1: 165,894,969	P349R	probably damaging	Het
Prmt8	A	T	6: 127,711,147	I236N	probably damaging	Het
Psg23	C	A	7: 18,612,201	V190L	probably benign	Het
Psg29	A	G	7: 17,205,025	K75E	possibly damaging	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,219,203		probably benign	Het
Rgs4	A	G	1: 169,744,422	S103P	probably damaging	Het
Sis	T	C	3: 72,921,414	Y1144C	probably damaging	Het
Slc16a14	T	C	1: 84,929,280		probably benign	Het
Snrnp35	T	A	5: 124,490,185	D20E	probably damaging	Het
Syce1l	C	A	8: 113,643,265	A10E	possibly damaging	Het
Tdp1	A	G	12: 99,891,752		probably benign	Het
Tmem2	T	G	19: 21,807,452	I433S	probably damaging	Het
Tmem212	T	C	3: 27,886,445		probably null	Het
Tomm20l	C	T	12: 71,111,742	A58V	possibly damaging	Het
Ttn	C	A	2: 76,738,127	C27474F	probably damaging	Het
Ttn	A	G	2: 76,974,208	V240A	probably benign	Het
Vars	A	G	17: 34,999,334	V48A	probably benign	Het
Vmn2r1	T	C	3: 64,086,764		probably null	Het
Washc2	A	G	6: 116,247,972		probably benign	Het
Zfp943	A	G	17: 21,992,422	D163G	possibly damaging	Het
Zmym5	T	C	14: 56,793,773	Y626C	probably damaging	Het

Other mutations in Lepr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Lepr	APN	4	101815035	missense	probably benign
IGL01111:Lepr	APN	4	101814655	missense	possibly damaging	0.77
IGL01324:Lepr	APN	4	101768068	missense	probably benign	0.23
IGL01372:Lepr	APN	4	101735577	missense	possibly damaging	0.67
IGL01626:Lepr	APN	4	101733534	missense	probably benign	0.10
IGL01733:Lepr	APN	4	101765082	missense	probably benign	0.00
IGL01815:Lepr	APN	4	101814790	missense	possibly damaging	0.49
IGL01899:Lepr	APN	4	101779987	missense	possibly damaging	0.86
IGL02138:Lepr	APN	4	101768067	missense	probably damaging	0.98
IGL02161:Lepr	APN	4	101745678	missense	probably damaging	0.97
IGL02653:Lepr	APN	4	101764944	missense	probably benign	0.44
IGL02735:Lepr	APN	4	101782638	missense	probably damaging	1.00
IGL03035:Lepr	APN	4	101764980	missense	probably damaging	1.00
IGL03083:Lepr	APN	4	101814679	nonsense	probably null
IGL03160:Lepr	APN	4	101764906	missense	probably damaging	1.00
aufsetzigen	UTSW	4	101752175	missense	probably damaging	1.00
business_class	UTSW	4	101764872	missense	probably damaging	1.00
cherub	UTSW	4	101768063	missense	probably benign	0.25
clodhopper	UTSW	4	101765290	splice site	probably null
donner	UTSW	4	101815201	missense	probably damaging	1.00
fluffy	UTSW	4	101792023	missense	probably damaging	1.00
giant	UTSW	4	101765152	critical splice donor site	probably null
gordo	UTSW	4	101765305	missense	probably damaging	0.97
Immunoglutton	UTSW	4	101765301	splice site	probably benign
Jumbo_shrimp	UTSW	4	101764954	nonsense	probably null
lowleaning	UTSW	4	101814391	splice site	probably null
odd	UTSW	4	101728075	splice site	probably benign
paleo	UTSW	4	101745645	missense	possibly damaging	0.94
well-upholstered	UTSW	4	101772959	synonymous	probably benign
worldly	UTSW	4	101768228	missense	possibly damaging	0.96
PIT4651001:Lepr	UTSW	4	101791997	missense	probably damaging	1.00
PIT4696001:Lepr	UTSW	4	101779983	missense	probably benign	0.10
R0140:Lepr	UTSW	4	101768067	missense	probably damaging	1.00
R0197:Lepr	UTSW	4	101752152	missense	possibly damaging	0.64
R0279:Lepr	UTSW	4	101750344	missense	probably benign	0.05
R0487:Lepr	UTSW	4	101768093	nonsense	probably null
R0498:Lepr	UTSW	4	101745692	missense	probably benign	0.01
R0506:Lepr	UTSW	4	101773010	splice site	probably benign
R0512:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R0512:Lepr	UTSW	4	101814704	missense	possibly damaging	0.87
R0726:Lepr	UTSW	4	101764934	missense	probably benign	0.01
R1054:Lepr	UTSW	4	101782596	missense	probably damaging	0.97
R1109:Lepr	UTSW	4	101771355	missense	probably damaging	1.00
R1398:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1519:Lepr	UTSW	4	101789344	missense	probably damaging	0.97
R1602:Lepr	UTSW	4	101745645	missense	possibly damaging	0.94
R1830:Lepr	UTSW	4	101735677	missense	probably damaging	1.00
R1850:Lepr	UTSW	4	101733423	missense	possibly damaging	0.67
R1918:Lepr	UTSW	4	101772836	missense	probably benign	0.08
R1928:Lepr	UTSW	4	101782730	splice site	probably benign
R2099:Lepr	UTSW	4	101772988	missense	probably damaging	1.00
R2102:Lepr	UTSW	4	101772981	missense	possibly damaging	0.95
R2175:Lepr	UTSW	4	101765379	missense	probably benign	0.01
R2254:Lepr	UTSW	4	101815112	missense	probably benign	0.26
R2396:Lepr	UTSW	4	101733528	missense	probably benign	0.19
R2508:Lepr	UTSW	4	101790896	missense	probably damaging	0.98
R2571:Lepr	UTSW	4	101768172	missense	possibly damaging	0.96
R3882:Lepr	UTSW	4	101815265	missense	probably damaging	1.00
R3933:Lepr	UTSW	4	101765301	splice site	probably benign
R4211:Lepr	UTSW	4	101733414	missense	probably benign	0.19
R4343:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4345:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4544:Lepr	UTSW	4	101768228	missense	possibly damaging	0.96
R4546:Lepr	UTSW	4	101814641	missense	probably benign	0.35
R4724:Lepr	UTSW	4	101765365	nonsense	probably null
R4797:Lepr	UTSW	4	101780047	missense	possibly damaging	0.90
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4929:Lepr	UTSW	4	101815117	missense	probably benign	0.00
R4939:Lepr	UTSW	4	101733438	missense	possibly damaging	0.78
R5377:Lepr	UTSW	4	101815019	missense	possibly damaging	0.71
R5520:Lepr	UTSW	4	101745537	missense	probably benign	0.00
R5966:Lepr	UTSW	4	101792127	intron	probably benign
R6092:Lepr	UTSW	4	101792023	missense	probably damaging	1.00
R6130:Lepr	UTSW	4	101765372	missense	probably damaging	0.99
R6168:Lepr	UTSW	4	101735592	missense	probably damaging	0.99
R6232:Lepr	UTSW	4	101814391	splice site	probably null
R6380:Lepr	UTSW	4	101764954	nonsense	probably null
R6427:Lepr	UTSW	4	101774257	missense	possibly damaging	0.47
R6428:Lepr	UTSW	4	101780098	missense	probably damaging	1.00
R6641:Lepr	UTSW	4	101765305	missense	probably damaging	0.97
R6650:Lepr	UTSW	4	101815201	missense	probably damaging	1.00
R6859:Lepr	UTSW	4	101765290	splice site	probably null
R7023:Lepr	UTSW	4	101789287	missense	probably damaging	1.00
R7145:Lepr	UTSW	4	101752197	missense	probably benign	0.00
R7174:Lepr	UTSW	4	101750338	missense	probably benign	0.01
R7179:Lepr	UTSW	4	101745659	missense	probably benign	0.06
R7189:Lepr	UTSW	4	101814764	missense	probably benign	0.00
R7426:Lepr	UTSW	4	101745656	missense	probably benign	0.03
R7531:Lepr	UTSW	4	101752175	missense	probably damaging	1.00
R7620:Lepr	UTSW	4	101752073	missense	probably benign	0.41
R7804:Lepr	UTSW	4	101782586	missense	probably damaging	1.00
R8022:Lepr	UTSW	4	101782557	missense	probably benign	0.32
R8142:Lepr	UTSW	4	101765419	missense	possibly damaging	0.93
R8227:Lepr	UTSW	4	101771362	missense	probably damaging	0.99
R8426:Lepr	UTSW	4	101814644	missense	probably benign	0.12
R8447:Lepr	UTSW	4	101814491	missense	probably benign	0.08
R8531:Lepr	UTSW	4	101765415	missense	probably damaging	1.00
X0026:Lepr	UTSW	4	101733327	missense	possibly damaging	0.47
Z1176:Lepr	UTSW	4	101745614	missense	probably damaging	0.99
Z1177:Lepr	UTSW	4	101735595	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGTTAGAATGTGCCCTGC -3'
(R):5'- GCTAATTCCTGAATGCATATACAGCAC -3'

Sequencing Primer
(F):5'- GCCCTGCACATGATTTTACAG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'

Posted On

2015-03-25