Incidental Mutation 'R3790:Psg29'
ID272491
Institutional Source Beutler Lab
Gene Symbol Psg29
Ensembl Gene ENSMUSG00000023159
Gene Namepregnancy-specific glycoprotein 29
Synonymscea17
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3790 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location17203477-17215760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17205025 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 75 (K75E)
Ref Sequence ENSEMBL: ENSMUSP00000075320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075934]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075934
AA Change: K75E

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075320
Gene: ENSMUSG00000023159
AA Change: K75E

DomainStartEndE-ValueType
IG 40 137 7.77e-1 SMART
IG 156 257 8.72e-4 SMART
IG 276 377 2.44e0 SMART
IGc2 393 457 3.06e-8 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 G A 17: 12,928,573 Q186* probably null Het
Alk A G 17: 72,603,432 L93P possibly damaging Het
Ankrd24 C T 10: 81,642,679 probably benign Het
Anks6 A T 4: 47,049,212 V231E probably damaging Het
Ap5z1 C T 5: 142,470,413 S329L probably benign Het
Asic4 C A 1: 75,469,841 probably benign Het
Cers4 C A 8: 4,518,285 Q113K possibly damaging Het
Ces3b A T 8: 105,086,888 I264F possibly damaging Het
Cops3 T C 11: 59,827,971 M166V probably benign Het
Corin T C 5: 72,435,298 Q184R probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Gm53 T C 11: 96,251,651 noncoding transcript Het
Hmcn1 A G 1: 150,622,994 S4045P probably benign Het
Kif22 A G 7: 127,029,496 L480P probably damaging Het
Lepr A T 4: 101,790,914 probably benign Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lnx1 A G 5: 74,628,366 probably benign Het
Lrsam1 T C 2: 32,958,159 E43G probably null Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Nbea T A 3: 56,005,029 E1112D probably benign Het
Nepn T A 10: 52,400,530 L60I probably damaging Het
Oas1e T C 5: 120,795,410 E30G probably damaging Het
Olfr1228 A G 2: 89,248,993 F234L probably benign Het
Olfr729 A C 14: 50,148,569 F102V possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Psg23 C A 7: 18,612,201 V190L probably benign Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Rgs4 A G 1: 169,744,422 S103P probably damaging Het
Sis T C 3: 72,921,414 Y1144C probably damaging Het
Slc16a14 T C 1: 84,929,280 probably benign Het
Snrnp35 T A 5: 124,490,185 D20E probably damaging Het
Syce1l C A 8: 113,643,265 A10E possibly damaging Het
Tdp1 A G 12: 99,891,752 probably benign Het
Tmem2 T G 19: 21,807,452 I433S probably damaging Het
Tmem212 T C 3: 27,886,445 probably null Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn C A 2: 76,738,127 C27474F probably damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vars A G 17: 34,999,334 V48A probably benign Het
Vmn2r1 T C 3: 64,086,764 probably null Het
Washc2 A G 6: 116,247,972 probably benign Het
Zfp943 A G 17: 21,992,422 D163G possibly damaging Het
Zmym5 T C 14: 56,793,773 Y626C probably damaging Het
Other mutations in Psg29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Psg29 APN 7 17208732 missense probably benign 0.42
IGL01107:Psg29 APN 7 17204925 missense probably benign 0.01
IGL01348:Psg29 APN 7 17210673 missense probably benign 0.09
IGL01353:Psg29 APN 7 17205013 missense possibly damaging 0.54
IGL02546:Psg29 APN 7 17208782 missense probably damaging 1.00
IGL02611:Psg29 APN 7 17208791 missense probably benign 0.15
IGL02982:Psg29 APN 7 17211707 missense probably damaging 0.98
IGL03072:Psg29 APN 7 17208794 missense probably benign 0.06
macular UTSW 7 17210535 missense probably benign 0.23
papular UTSW 7 17211912 makesense probably null
R1744:Psg29 UTSW 7 17210353 missense probably damaging 1.00
R2272:Psg29 UTSW 7 17210696 missense probably benign 0.19
R3054:Psg29 UTSW 7 17208802 missense probably benign 0.29
R3963:Psg29 UTSW 7 17208585 missense probably benign 0.01
R4464:Psg29 UTSW 7 17210650 missense possibly damaging 0.61
R4740:Psg29 UTSW 7 17208533 missense probably benign 0.00
R4774:Psg29 UTSW 7 17210535 missense probably benign 0.23
R4902:Psg29 UTSW 7 17211912 makesense probably null
R4977:Psg29 UTSW 7 17208631 missense probably damaging 1.00
R5071:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5072:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5074:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5169:Psg29 UTSW 7 17211653 missense probably damaging 1.00
R5415:Psg29 UTSW 7 17211636 splice site probably null
R5729:Psg29 UTSW 7 17210534 missense probably damaging 0.98
R6023:Psg29 UTSW 7 17210512 missense possibly damaging 0.82
R6127:Psg29 UTSW 7 17211746 missense probably benign 0.00
R6900:Psg29 UTSW 7 17204932 nonsense probably null
R7142:Psg29 UTSW 7 17210621 missense probably damaging 1.00
R7297:Psg29 UTSW 7 17210691 nonsense probably null
R7448:Psg29 UTSW 7 17211723 missense possibly damaging 0.90
R7973:Psg29 UTSW 7 17210537 missense probably benign 0.03
R8027:Psg29 UTSW 7 17208640 missense possibly damaging 0.69
X0017:Psg29 UTSW 7 17210661 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCAAGACGTAAGCTGAGTG -3'
(R):5'- AAAGAATCACTTACGGTTCACG -3'

Sequencing Primer
(F):5'- CTGATCACACCTGCTTAATACTGAGG -3'
(R):5'- CGGTTCACGTGGAGGAATG -3'
Posted On2015-03-25