Incidental Mutation 'R3790:Tomm20l'
ID272503
Institutional Source Beutler Lab
Gene Symbol Tomm20l
Ensembl Gene ENSMUSG00000021078
Gene Nametranslocase of outer mitochondrial membrane 20-like
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3790 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location71111428-71123221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71111742 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 58 (A58V)
Ref Sequence ENSEMBL: ENSMUSP00000021482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021482] [ENSMUST00000220834]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021482
AA Change: A58V

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021482
Gene: ENSMUSG00000021078
AA Change: A58V

DomainStartEndE-ValueType
Pfam:MAS20 14 128 7.6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221962
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 G A 17: 12,928,573 Q186* probably null Het
Alk A G 17: 72,603,432 L93P possibly damaging Het
Ankrd24 C T 10: 81,642,679 probably benign Het
Anks6 A T 4: 47,049,212 V231E probably damaging Het
Ap5z1 C T 5: 142,470,413 S329L probably benign Het
Asic4 C A 1: 75,469,841 probably benign Het
Cers4 C A 8: 4,518,285 Q113K possibly damaging Het
Ces3b A T 8: 105,086,888 I264F possibly damaging Het
Cops3 T C 11: 59,827,971 M166V probably benign Het
Corin T C 5: 72,435,298 Q184R probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Gm53 T C 11: 96,251,651 noncoding transcript Het
Hmcn1 A G 1: 150,622,994 S4045P probably benign Het
Kif22 A G 7: 127,029,496 L480P probably damaging Het
Lepr A T 4: 101,790,914 probably benign Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lnx1 A G 5: 74,628,366 probably benign Het
Lrsam1 T C 2: 32,958,159 E43G probably null Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Nbea T A 3: 56,005,029 E1112D probably benign Het
Nepn T A 10: 52,400,530 L60I probably damaging Het
Oas1e T C 5: 120,795,410 E30G probably damaging Het
Olfr1228 A G 2: 89,248,993 F234L probably benign Het
Olfr729 A C 14: 50,148,569 F102V possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Psg23 C A 7: 18,612,201 V190L probably benign Het
Psg29 A G 7: 17,205,025 K75E possibly damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Rgs4 A G 1: 169,744,422 S103P probably damaging Het
Sis T C 3: 72,921,414 Y1144C probably damaging Het
Slc16a14 T C 1: 84,929,280 probably benign Het
Snrnp35 T A 5: 124,490,185 D20E probably damaging Het
Syce1l C A 8: 113,643,265 A10E possibly damaging Het
Tdp1 A G 12: 99,891,752 probably benign Het
Tmem2 T G 19: 21,807,452 I433S probably damaging Het
Tmem212 T C 3: 27,886,445 probably null Het
Ttn C A 2: 76,738,127 C27474F probably damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vars A G 17: 34,999,334 V48A probably benign Het
Vmn2r1 T C 3: 64,086,764 probably null Het
Washc2 A G 6: 116,247,972 probably benign Het
Zfp943 A G 17: 21,992,422 D163G possibly damaging Het
Zmym5 T C 14: 56,793,773 Y626C probably damaging Het
Other mutations in Tomm20l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03340:Tomm20l APN 12 71117614 splice site probably benign
R0544:Tomm20l UTSW 12 71123077 missense possibly damaging 0.84
R3788:Tomm20l UTSW 12 71111742 missense possibly damaging 0.93
R3789:Tomm20l UTSW 12 71111742 missense possibly damaging 0.93
R3962:Tomm20l UTSW 12 71117578 missense probably benign 0.31
R6674:Tomm20l UTSW 12 71111533 missense probably damaging 0.99
R7148:Tomm20l UTSW 12 71117539 missense probably benign 0.00
R7545:Tomm20l UTSW 12 71117397 splice site probably null
R8281:Tomm20l UTSW 12 71111467 missense probably benign 0.18
Z1187:Tomm20l UTSW 12 71121984 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TACTGCGTCTACCTGGACTG -3'
(R):5'- CCTACCACATGTAATTTACAGATGCC -3'

Sequencing Primer
(F):5'- TCTACCTGGACTGGAGGC -3'
(R):5'- AGCGATGATTCTGCACACTG -3'
Posted On2015-03-25