Incidental Mutation 'R3790:Olfr729'
ID272505
Institutional Source Beutler Lab
Gene Symbol Olfr729
Ensembl Gene ENSMUSG00000049011
Gene Nameolfactory receptor 729
SynonymsMOR246-6, GA_x6K02T2PMLR-5839874-5838903
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R3790 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50144731-50152910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 50148569 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 102 (F102V)
Ref Sequence ENSEMBL: ENSMUSP00000149189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061020] [ENSMUST00000213163] [ENSMUST00000215327] [ENSMUST00000215451]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061020
AA Change: F102V

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000051755
Gene: ENSMUSG00000049011
AA Change: F102V

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 8.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 286 1.4e-5 PFAM
Pfam:7tm_1 41 287 2.4e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213163
AA Change: F102V

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215327
AA Change: F102V

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215451
AA Change: F102V

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 G A 17: 12,928,573 Q186* probably null Het
Alk A G 17: 72,603,432 L93P possibly damaging Het
Ankrd24 C T 10: 81,642,679 probably benign Het
Anks6 A T 4: 47,049,212 V231E probably damaging Het
Ap5z1 C T 5: 142,470,413 S329L probably benign Het
Asic4 C A 1: 75,469,841 probably benign Het
Cers4 C A 8: 4,518,285 Q113K possibly damaging Het
Ces3b A T 8: 105,086,888 I264F possibly damaging Het
Cops3 T C 11: 59,827,971 M166V probably benign Het
Corin T C 5: 72,435,298 Q184R probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Gm53 T C 11: 96,251,651 noncoding transcript Het
Hmcn1 A G 1: 150,622,994 S4045P probably benign Het
Kif22 A G 7: 127,029,496 L480P probably damaging Het
Lepr A T 4: 101,790,914 probably benign Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lnx1 A G 5: 74,628,366 probably benign Het
Lrsam1 T C 2: 32,958,159 E43G probably null Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Nbea T A 3: 56,005,029 E1112D probably benign Het
Nepn T A 10: 52,400,530 L60I probably damaging Het
Oas1e T C 5: 120,795,410 E30G probably damaging Het
Olfr1228 A G 2: 89,248,993 F234L probably benign Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Psg23 C A 7: 18,612,201 V190L probably benign Het
Psg29 A G 7: 17,205,025 K75E possibly damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Rgs4 A G 1: 169,744,422 S103P probably damaging Het
Sis T C 3: 72,921,414 Y1144C probably damaging Het
Slc16a14 T C 1: 84,929,280 probably benign Het
Snrnp35 T A 5: 124,490,185 D20E probably damaging Het
Syce1l C A 8: 113,643,265 A10E possibly damaging Het
Tdp1 A G 12: 99,891,752 probably benign Het
Tmem2 T G 19: 21,807,452 I433S probably damaging Het
Tmem212 T C 3: 27,886,445 probably null Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn C A 2: 76,738,127 C27474F probably damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vars A G 17: 34,999,334 V48A probably benign Het
Vmn2r1 T C 3: 64,086,764 probably null Het
Washc2 A G 6: 116,247,972 probably benign Het
Zfp943 A G 17: 21,992,422 D163G possibly damaging Het
Zmym5 T C 14: 56,793,773 Y626C probably damaging Het
Other mutations in Olfr729
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Olfr729 APN 14 50148716 missense probably benign 0.38
IGL02736:Olfr729 APN 14 50148424 missense probably benign 0.01
IGL02798:Olfr729 APN 14 50148378 missense probably benign
IGL03267:Olfr729 APN 14 50148847 missense probably damaging 1.00
R0082:Olfr729 UTSW 14 50148055 missense probably damaging 0.97
R0225:Olfr729 UTSW 14 50148635 missense probably damaging 1.00
R0503:Olfr729 UTSW 14 50148478 missense probably damaging 1.00
R1022:Olfr729 UTSW 14 50147927 missense probably benign
R1024:Olfr729 UTSW 14 50147927 missense probably benign
R1424:Olfr729 UTSW 14 50148465 missense possibly damaging 0.83
R1440:Olfr729 UTSW 14 50148358 missense probably damaging 1.00
R1479:Olfr729 UTSW 14 50148788 missense probably benign 0.00
R1583:Olfr729 UTSW 14 50148774 missense probably benign 0.00
R1817:Olfr729 UTSW 14 50148271 missense probably benign 0.00
R2155:Olfr729 UTSW 14 50148697 missense probably damaging 1.00
R2282:Olfr729 UTSW 14 50148319 missense probably benign
R2926:Olfr729 UTSW 14 50148436 missense probably benign 0.19
R4073:Olfr729 UTSW 14 50148043 missense possibly damaging 0.55
R5945:Olfr729 UTSW 14 50148763 missense probably benign
R6714:Olfr729 UTSW 14 50148214 missense possibly damaging 0.95
R7112:Olfr729 UTSW 14 50147935 missense probably benign 0.00
R7157:Olfr729 UTSW 14 50148232 missense probably damaging 1.00
R7511:Olfr729 UTSW 14 50148256 missense probably damaging 1.00
R7815:Olfr729 UTSW 14 50148796 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TCAATGTGTGTACCAAGCCC -3'
(R):5'- TCTCGGGAACTTCAGATTTTCTAC -3'

Sequencing Primer
(F):5'- GTGTGTACCAAGCCCACAGC -3'
(R):5'- GGAAACCTTCTCATCATCATAGCTG -3'
Posted On2015-03-25