Incidental Mutation 'R3790:Vars'
ID272511
Institutional Source Beutler Lab
Gene Symbol Vars
Ensembl Gene ENSMUSG00000007029
Gene Namevalyl-tRNA synthetase
SynonymsBat-6, Bat6, G7a, D17H6S56E, Vars2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R3790 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35000987-35016322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34999334 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 48 (V48A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087315] [ENSMUST00000172570] [ENSMUST00000173584] [ENSMUST00000174260]
Predicted Effect probably benign
Transcript: ENSMUST00000087315
SMART Domains Protein: ENSMUSP00000084572
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
Pfam:GST_N 2 81 5.7e-16 PFAM
Pfam:GST_C 107 198 7.3e-13 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 2e-197 PFAM
Pfam:tRNA-synt_1g 336 496 6e-6 PFAM
Pfam:tRNA-synt_1_2 555 623 1.9e-11 PFAM
Pfam:Anticodon_1 983 1138 2.6e-34 PFAM
low complexity region 1153 1174 N/A INTRINSIC
low complexity region 1207 1225 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166828
AA Change: V48A

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133003
Gene: ENSMUSG00000091747
AA Change: V48A

DomainStartEndE-ValueType
Pfam:TLV_coat 37 582 2.4e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172570
SMART Domains Protein: ENSMUSP00000134245
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
Pfam:GST_C 2 76 1.2e-13 PFAM
low complexity region 112 124 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172656
Predicted Effect probably benign
Transcript: ENSMUST00000173584
SMART Domains Protein: ENSMUSP00000133994
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
Pfam:GST_C 96 198 7.8e-14 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 1.9e-200 PFAM
Pfam:tRNA-synt_1g 336 493 2.1e-7 PFAM
Pfam:tRNA-synt_1_2 555 623 1.1e-12 PFAM
Pfam:Anticodon_1 983 1138 7.2e-36 PFAM
low complexity region 1153 1174 N/A INTRINSIC
coiled coil region 1197 1225 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174260
SMART Domains Protein: ENSMUSP00000134313
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
Pfam:GST_N 2 81 2.2e-16 PFAM
Pfam:GST_C 96 198 2.1e-13 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. The protein encoded by this gene belongs to class-I aminoacyl-tRNA synthetase family and is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 G A 17: 12,928,573 Q186* probably null Het
Alk A G 17: 72,603,432 L93P possibly damaging Het
Ankrd24 C T 10: 81,642,679 probably benign Het
Anks6 A T 4: 47,049,212 V231E probably damaging Het
Ap5z1 C T 5: 142,470,413 S329L probably benign Het
Asic4 C A 1: 75,469,841 probably benign Het
Cers4 C A 8: 4,518,285 Q113K possibly damaging Het
Ces3b A T 8: 105,086,888 I264F possibly damaging Het
Cops3 T C 11: 59,827,971 M166V probably benign Het
Corin T C 5: 72,435,298 Q184R probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Gm53 T C 11: 96,251,651 noncoding transcript Het
Hmcn1 A G 1: 150,622,994 S4045P probably benign Het
Kif22 A G 7: 127,029,496 L480P probably damaging Het
Lepr A T 4: 101,790,914 probably benign Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lnx1 A G 5: 74,628,366 probably benign Het
Lrsam1 T C 2: 32,958,159 E43G probably null Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Nbea T A 3: 56,005,029 E1112D probably benign Het
Nepn T A 10: 52,400,530 L60I probably damaging Het
Oas1e T C 5: 120,795,410 E30G probably damaging Het
Olfr1228 A G 2: 89,248,993 F234L probably benign Het
Olfr729 A C 14: 50,148,569 F102V possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Psg23 C A 7: 18,612,201 V190L probably benign Het
Psg29 A G 7: 17,205,025 K75E possibly damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Rgs4 A G 1: 169,744,422 S103P probably damaging Het
Sis T C 3: 72,921,414 Y1144C probably damaging Het
Slc16a14 T C 1: 84,929,280 probably benign Het
Snrnp35 T A 5: 124,490,185 D20E probably damaging Het
Syce1l C A 8: 113,643,265 A10E possibly damaging Het
Tdp1 A G 12: 99,891,752 probably benign Het
Tmem2 T G 19: 21,807,452 I433S probably damaging Het
Tmem212 T C 3: 27,886,445 probably null Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn C A 2: 76,738,127 C27474F probably damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r1 T C 3: 64,086,764 probably null Het
Washc2 A G 6: 116,247,972 probably benign Het
Zfp943 A G 17: 21,992,422 D163G possibly damaging Het
Zmym5 T C 14: 56,793,773 Y626C probably damaging Het
Other mutations in Vars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Vars APN 17 35013873 missense probably benign 0.00
IGL02160:Vars APN 17 35001502 missense probably damaging 1.00
IGL02303:Vars APN 17 35015484 splice site probably benign
IGL03027:Vars APN 17 35013687 missense probably damaging 1.00
Maladroit UTSW 17 35005475 missense probably benign 0.30
Whoops UTSW 17 35013644 missense probably damaging 1.00
FR4304:Vars UTSW 17 35015989 small insertion probably benign
FR4548:Vars UTSW 17 35015989 small insertion probably benign
FR4548:Vars UTSW 17 35015991 small insertion probably benign
FR4589:Vars UTSW 17 35015988 small insertion probably benign
R0045:Vars UTSW 17 35010619 missense probably damaging 1.00
R0045:Vars UTSW 17 34998066 missense probably benign 0.13
R0045:Vars UTSW 17 35010619 missense probably damaging 1.00
R0266:Vars UTSW 17 35013869 missense probably benign 0.00
R0267:Vars UTSW 17 35011596 splice site probably benign
R0391:Vars UTSW 17 35011486 missense possibly damaging 0.79
R0445:Vars UTSW 17 35011809 missense probably benign 0.31
R0449:Vars UTSW 17 35012727 splice site probably null
R0557:Vars UTSW 17 35004984 missense possibly damaging 0.90
R0559:Vars UTSW 17 35014058 nonsense probably null
R0730:Vars UTSW 17 35014300 missense probably damaging 1.00
R0748:Vars UTSW 17 34998012 missense probably damaging 1.00
R1692:Vars UTSW 17 35013725 missense probably damaging 1.00
R1693:Vars UTSW 17 34998196 missense probably benign 0.31
R1697:Vars UTSW 17 34998222 missense probably benign 0.43
R1699:Vars UTSW 17 35014758 missense possibly damaging 0.93
R1712:Vars UTSW 17 35014752 missense probably damaging 1.00
R1989:Vars UTSW 17 35011838 missense possibly damaging 0.94
R2349:Vars UTSW 17 35015752 missense probably benign
R2365:Vars UTSW 17 35015452 missense probably benign 0.01
R4615:Vars UTSW 17 35013881 missense probably damaging 0.97
R4844:Vars UTSW 17 35011612 missense probably damaging 1.00
R4856:Vars UTSW 17 35015726 missense probably benign 0.37
R4886:Vars UTSW 17 35015726 missense probably benign 0.37
R5570:Vars UTSW 17 35016238 missense probably benign 0.04
R5706:Vars UTSW 17 35005481 splice site probably null
R5858:Vars UTSW 17 35005475 missense probably benign 0.30
R5907:Vars UTSW 17 35012376 missense probably damaging 1.00
R5917:Vars UTSW 17 35012515 missense probably damaging 0.99
R5944:Vars UTSW 17 35013644 missense probably damaging 1.00
R6023:Vars UTSW 17 35001609 missense probably damaging 1.00
R6073:Vars UTSW 17 35001529 missense probably benign
R6273:Vars UTSW 17 35013743 missense probably damaging 1.00
R6390:Vars UTSW 17 35015639 missense probably benign 0.00
R6658:Vars UTSW 17 35015741 missense probably benign 0.03
R7067:Vars UTSW 17 35011479 missense probably damaging 0.98
R7387:Vars UTSW 17 35004792 nonsense probably null
R7954:Vars UTSW 17 35015984 missense probably benign 0.01
R8139:Vars UTSW 17 35011504 missense probably benign 0.16
R8347:Vars UTSW 17 35015977 missense possibly damaging 0.92
R8387:Vars UTSW 17 35010514 missense probably damaging 0.99
Z1177:Vars UTSW 17 35011477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGAAGTTCACTGTGTTGAGC -3'
(R):5'- ATGGATTGGGCCAAACATGG -3'

Sequencing Primer
(F):5'- TTGAGCTGGATGTTGACACCCC -3'
(R):5'- CCAAACATGGCAGATCTATGC -3'
Posted On2015-03-25