Incidental Mutation 'R3792:Kyat3'
ID272578
Institutional Source Beutler Lab
Gene Symbol Kyat3
Ensembl Gene ENSMUSG00000040213
Gene Namekynurenine aminotransferase 3
SynonymsKat3, KATIII, Ccbl2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R3792 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location142701051-142746870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142737844 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 406 (K406M)
Ref Sequence ENSEMBL: ENSMUSP00000101825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044392] [ENSMUST00000106218] [ENSMUST00000129775]
Predicted Effect probably null
Transcript: ENSMUST00000044392
AA Change: K371M

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041675
Gene: ENSMUSG00000040213
AA Change: K371M

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 29 411 5.8e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106218
AA Change: K406M

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101825
Gene: ENSMUSG00000040213
AA Change: K406M

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 64 446 4.8e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128096
Predicted Effect probably benign
Transcript: ENSMUST00000129775
SMART Domains Protein: ENSMUSP00000121687
Gene: ENSMUSG00000040213

DomainStartEndE-ValueType
PDB:3E2Z|B 7 69 3e-37 PDB
SCOP:d1gdea_ 8 70 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198957
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an aminotransferase that transaminates kynurenine to form kynurenic acid, which is a metabolite of tryptophan. Multiple alternatively spliced transcript variants that encode different proteins have been described for this gene. This gene shares 5' exon structure with the RNA binding motif protein, X-linked-like 1 locus on chromosome 1, but the coding sequences are non-overlapping. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik A G X: 81,420,817 V428A probably benign Het
Aanat T C 11: 116,596,231 L88P probably damaging Het
Arhgap5 A T 12: 52,519,888 N1214I probably benign Het
BC034090 A T 1: 155,241,797 S192T probably damaging Het
Bco1 G A 8: 117,130,676 V461I possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cubn G A 2: 13,427,914 R1199C probably damaging Het
Dcaf12l1 T C X: 44,788,436 N495S possibly damaging Het
Dopey2 C A 16: 93,771,846 Q1599K possibly damaging Het
Dyrk1a C A 16: 94,685,074 L427I probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
F8 A T X: 75,285,365 probably null Het
Fam135a T C 1: 24,028,311 Y259C probably benign Het
Fbxo38 T C 18: 62,533,462 probably null Het
Fbxo43 T C 15: 36,162,859 I67M probably benign Het
Gcfc2 G T 6: 81,930,767 C154F probably benign Het
Gm21731 G T 13: 120,240,931 V88F probably damaging Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Ilk G A 7: 105,742,087 W73* probably null Het
Ism1 T C 2: 139,740,253 S162P probably damaging Het
Itpkb T A 1: 180,333,173 L288Q possibly damaging Het
Itpr2 C A 6: 146,415,354 K306N probably damaging Het
Kdm2a C T 19: 4,324,512 E864K possibly damaging Het
Kdm4b G A 17: 56,355,944 V172M probably damaging Het
Lipe T A 7: 25,397,620 K299N possibly damaging Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Mptx2 T A 1: 173,274,673 I150F probably damaging Het
Mroh2b G T 15: 4,923,620 W612L probably damaging Het
Mucl2 T C 15: 103,898,426 T27A possibly damaging Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Olfr164 A G 16: 19,285,946 S266P possibly damaging Het
Olfr624 A T 7: 103,670,146 I295N probably damaging Het
Oprm1 T C 10: 6,839,544 S390P probably benign Het
Pcdhb14 T C 18: 37,449,662 L607P probably damaging Het
Rap1gds1 A T 3: 138,965,960 I133N probably damaging Het
Rasl10a T C 11: 5,059,461 L83S probably damaging Het
Satb2 C T 1: 56,845,620 V382M probably damaging Het
Sh3gl1 T C 17: 56,018,949 K160R probably damaging Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spef2 A G 15: 9,704,536 I454T probably damaging Het
Stag3 A G 5: 138,298,349 K490E probably benign Het
Tctn3 T C 19: 40,611,711 K95R probably benign Het
Tdgf1 C T 9: 110,943,190 R46Q probably benign Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Ttc21a A T 9: 119,954,165 E511V probably damaging Het
Ttn A G 2: 76,711,888 F25258L probably damaging Het
Ttn A C 2: 76,808,946 C13828G probably damaging Het
Vmn1r210 T A 13: 22,827,403 M238L probably damaging Het
Vmn1r38 A G 6: 66,776,907 I75T probably benign Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwa7 T C 17: 35,025,159 probably null Het
Zfp128 T A 7: 12,884,732 D52E probably damaging Het
Zfp618 T C 4: 63,115,491 probably benign Het
Zkscan2 T A 7: 123,485,002 E633V possibly damaging Het
Other mutations in Kyat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Kyat3 APN 3 142734474 missense probably benign 0.25
IGL00228:Kyat3 APN 3 142726257 missense probably damaging 1.00
IGL02065:Kyat3 APN 3 142720375 missense probably benign 0.07
IGL02529:Kyat3 APN 3 142720474 missense probably benign
IGL02665:Kyat3 APN 3 142734466 splice site probably null
IGL03399:Kyat3 APN 3 142726010 missense probably damaging 0.99
R1013:Kyat3 UTSW 3 142726246 missense probably damaging 0.97
R1180:Kyat3 UTSW 3 142737770 critical splice acceptor site probably null
R1181:Kyat3 UTSW 3 142737770 critical splice acceptor site probably null
R1236:Kyat3 UTSW 3 142738259 missense probably benign
R1826:Kyat3 UTSW 3 142723179 missense possibly damaging 0.86
R4165:Kyat3 UTSW 3 142726305 splice site probably null
R4332:Kyat3 UTSW 3 142725426 missense probably damaging 1.00
R4353:Kyat3 UTSW 3 142731293 critical splice donor site probably null
R5257:Kyat3 UTSW 3 142734576 missense probably benign 0.07
R5396:Kyat3 UTSW 3 142734606 missense probably benign 0.03
R5687:Kyat3 UTSW 3 142734582 missense probably null 0.00
R5933:Kyat3 UTSW 3 142723260 missense probably damaging 1.00
R6374:Kyat3 UTSW 3 142738237 missense probably damaging 1.00
R6537:Kyat3 UTSW 3 142729812 missense probably benign 0.12
R6938:Kyat3 UTSW 3 142725422 missense probably damaging 1.00
R7092:Kyat3 UTSW 3 142729795 missense probably damaging 1.00
R7176:Kyat3 UTSW 3 142737839 missense possibly damaging 0.73
R7203:Kyat3 UTSW 3 142720401 missense probably damaging 0.97
R7252:Kyat3 UTSW 3 142720458 missense probably benign 0.05
R7487:Kyat3 UTSW 3 142726194 nonsense probably null
R7522:Kyat3 UTSW 3 142734544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCAGGGTGTATGAATAACC -3'
(R):5'- CTAGGTGGACTCTTTGTATGAAAGG -3'

Sequencing Primer
(F):5'- CAGCAGGGTGTATGAATAACCTCTAG -3'
(R):5'- GCTAGCCTGGTCTATATAGCAAG -3'
Posted On2015-03-25