Incidental Mutation 'R3792:Zkscan2'
ID272591
Institutional Source Beutler Lab
Gene Symbol Zkscan2
Ensembl Gene ENSMUSG00000030757
Gene Namezinc finger with KRAB and SCAN domains 2
Synonyms9430065N20Rik, Zfp694
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R3792 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location123475384-123500449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123485002 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 633 (E633V)
Ref Sequence ENSEMBL: ENSMUSP00000041821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042470]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042470
AA Change: E633V

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041821
Gene: ENSMUSG00000030757
AA Change: E633V

DomainStartEndE-ValueType
SCAN 41 148 1.62e-54 SMART
KRAB 222 282 1.71e-2 SMART
SANT 333 397 3.73e0 SMART
low complexity region 449 469 N/A INTRINSIC
SANT 489 553 2.18e0 SMART
low complexity region 627 649 N/A INTRINSIC
ZnF_C2H2 768 790 6.42e-4 SMART
ZnF_C2H2 796 818 7.9e-4 SMART
ZnF_C2H2 824 846 5.99e-4 SMART
ZnF_C2H2 852 874 3.21e-4 SMART
ZnF_C2H2 880 902 1.18e-2 SMART
ZnF_C2H2 908 930 8.81e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206148
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik A G X: 81,420,817 V428A probably benign Het
Aanat T C 11: 116,596,231 L88P probably damaging Het
Arhgap5 A T 12: 52,519,888 N1214I probably benign Het
BC034090 A T 1: 155,241,797 S192T probably damaging Het
Bco1 G A 8: 117,130,676 V461I possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cubn G A 2: 13,427,914 R1199C probably damaging Het
Dcaf12l1 T C X: 44,788,436 N495S possibly damaging Het
Dopey2 C A 16: 93,771,846 Q1599K possibly damaging Het
Dyrk1a C A 16: 94,685,074 L427I probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
F8 A T X: 75,285,365 probably null Het
Fam135a T C 1: 24,028,311 Y259C probably benign Het
Fbxo38 T C 18: 62,533,462 probably null Het
Fbxo43 T C 15: 36,162,859 I67M probably benign Het
Gcfc2 G T 6: 81,930,767 C154F probably benign Het
Gm21731 G T 13: 120,240,931 V88F probably damaging Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Ilk G A 7: 105,742,087 W73* probably null Het
Ism1 T C 2: 139,740,253 S162P probably damaging Het
Itpkb T A 1: 180,333,173 L288Q possibly damaging Het
Itpr2 C A 6: 146,415,354 K306N probably damaging Het
Kdm2a C T 19: 4,324,512 E864K possibly damaging Het
Kdm4b G A 17: 56,355,944 V172M probably damaging Het
Kyat3 A T 3: 142,737,844 K406M probably null Het
Lipe T A 7: 25,397,620 K299N possibly damaging Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Mptx2 T A 1: 173,274,673 I150F probably damaging Het
Mroh2b G T 15: 4,923,620 W612L probably damaging Het
Mucl2 T C 15: 103,898,426 T27A possibly damaging Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Olfr164 A G 16: 19,285,946 S266P possibly damaging Het
Olfr624 A T 7: 103,670,146 I295N probably damaging Het
Oprm1 T C 10: 6,839,544 S390P probably benign Het
Pcdhb14 T C 18: 37,449,662 L607P probably damaging Het
Rap1gds1 A T 3: 138,965,960 I133N probably damaging Het
Rasl10a T C 11: 5,059,461 L83S probably damaging Het
Satb2 C T 1: 56,845,620 V382M probably damaging Het
Sh3gl1 T C 17: 56,018,949 K160R probably damaging Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spef2 A G 15: 9,704,536 I454T probably damaging Het
Stag3 A G 5: 138,298,349 K490E probably benign Het
Tctn3 T C 19: 40,611,711 K95R probably benign Het
Tdgf1 C T 9: 110,943,190 R46Q probably benign Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Ttc21a A T 9: 119,954,165 E511V probably damaging Het
Ttn A G 2: 76,711,888 F25258L probably damaging Het
Ttn A C 2: 76,808,946 C13828G probably damaging Het
Vmn1r210 T A 13: 22,827,403 M238L probably damaging Het
Vmn1r38 A G 6: 66,776,907 I75T probably benign Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwa7 T C 17: 35,025,159 probably null Het
Zfp128 T A 7: 12,884,732 D52E probably damaging Het
Zfp618 T C 4: 63,115,491 probably benign Het
Other mutations in Zkscan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Zkscan2 APN 7 123479972 missense probably damaging 1.00
IGL02098:Zkscan2 APN 7 123499841 missense probably benign 0.02
IGL03093:Zkscan2 APN 7 123494850 missense probably benign 0.01
R0016:Zkscan2 UTSW 7 123499996 start gained probably benign
R0135:Zkscan2 UTSW 7 123480641 missense possibly damaging 0.63
R0541:Zkscan2 UTSW 7 123480200 missense possibly damaging 0.92
R0569:Zkscan2 UTSW 7 123498675 missense probably benign 0.11
R1537:Zkscan2 UTSW 7 123499841 missense possibly damaging 0.95
R1726:Zkscan2 UTSW 7 123489823 missense probably damaging 1.00
R3802:Zkscan2 UTSW 7 123495142 intron probably benign
R3803:Zkscan2 UTSW 7 123495142 intron probably benign
R3804:Zkscan2 UTSW 7 123495142 intron probably benign
R4012:Zkscan2 UTSW 7 123498660 missense possibly damaging 0.76
R4111:Zkscan2 UTSW 7 123482684 intron probably benign
R4605:Zkscan2 UTSW 7 123498724 missense probably damaging 1.00
R4978:Zkscan2 UTSW 7 123495319 missense possibly damaging 0.86
R5004:Zkscan2 UTSW 7 123490044 missense probably damaging 1.00
R5163:Zkscan2 UTSW 7 123499867 missense probably benign 0.01
R5753:Zkscan2 UTSW 7 123480700 missense probably benign
R5830:Zkscan2 UTSW 7 123480100 missense possibly damaging 0.47
R6153:Zkscan2 UTSW 7 123489770 missense probably benign 0.06
R6912:Zkscan2 UTSW 7 123499973 start gained probably benign
R7170:Zkscan2 UTSW 7 123499807 missense possibly damaging 0.83
R7269:Zkscan2 UTSW 7 123489771 missense probably benign
R7310:Zkscan2 UTSW 7 123490053 missense possibly damaging 0.53
R7399:Zkscan2 UTSW 7 123480104 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAACAGGGACCATTTTACTTAGTTC -3'
(R):5'- TGGTTAACTGCCGTCCATCC -3'

Sequencing Primer
(F):5'- GCAAACAGCACTCAAATATCTTCTG -3'
(R):5'- CTCCCTTTCCACCAACACCTCAG -3'
Posted On2015-03-25