Incidental Mutation 'R3792:Tdgf1'
ID272594
Institutional Source Beutler Lab
Gene Symbol Tdgf1
Ensembl Gene ENSMUSG00000032494
Gene Nameteratocarcinoma-derived growth factor 1
SynonymsCR1, cripto
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R3792 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110939603-110946158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110943190 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 46 (R46Q)
Ref Sequence ENSEMBL: ENSMUSP00000035075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035075] [ENSMUST00000197460] [ENSMUST00000199196] [ENSMUST00000199782]
Predicted Effect probably benign
Transcript: ENSMUST00000035075
AA Change: R46Q

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035075
Gene: ENSMUSG00000032494
AA Change: R46Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 65 91 1.8e1 SMART
Pfam:CFC 99 133 2.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197460
AA Change: R46Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143394
Gene: ENSMUSG00000032494
AA Change: R46Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000199196
AA Change: G47S
SMART Domains Protein: ENSMUSP00000142397
Gene: ENSMUSG00000032494
AA Change: G47S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199782
SMART Domains Protein: ENSMUSP00000143669
Gene: ENSMUSG00000032494

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 31 57 8.9e-2 SMART
Pfam:CFC 65 90 1.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an epidermal growth factor-related protein that contains a cripto, FRL-1, and cryptic domain. The encoded protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic development and tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in rostral-caudal axis formation, embryonic development and heart development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik A G X: 81,420,817 V428A probably benign Het
Aanat T C 11: 116,596,231 L88P probably damaging Het
Arhgap5 A T 12: 52,519,888 N1214I probably benign Het
BC034090 A T 1: 155,241,797 S192T probably damaging Het
Bco1 G A 8: 117,130,676 V461I possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cubn G A 2: 13,427,914 R1199C probably damaging Het
Dcaf12l1 T C X: 44,788,436 N495S possibly damaging Het
Dopey2 C A 16: 93,771,846 Q1599K possibly damaging Het
Dyrk1a C A 16: 94,685,074 L427I probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
F8 A T X: 75,285,365 probably null Het
Fam135a T C 1: 24,028,311 Y259C probably benign Het
Fbxo38 T C 18: 62,533,462 probably null Het
Fbxo43 T C 15: 36,162,859 I67M probably benign Het
Gcfc2 G T 6: 81,930,767 C154F probably benign Het
Gm21731 G T 13: 120,240,931 V88F probably damaging Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Ilk G A 7: 105,742,087 W73* probably null Het
Ism1 T C 2: 139,740,253 S162P probably damaging Het
Itpkb T A 1: 180,333,173 L288Q possibly damaging Het
Itpr2 C A 6: 146,415,354 K306N probably damaging Het
Kdm2a C T 19: 4,324,512 E864K possibly damaging Het
Kdm4b G A 17: 56,355,944 V172M probably damaging Het
Kyat3 A T 3: 142,737,844 K406M probably null Het
Lipe T A 7: 25,397,620 K299N possibly damaging Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Mptx2 T A 1: 173,274,673 I150F probably damaging Het
Mroh2b G T 15: 4,923,620 W612L probably damaging Het
Mucl2 T C 15: 103,898,426 T27A possibly damaging Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Olfr164 A G 16: 19,285,946 S266P possibly damaging Het
Olfr624 A T 7: 103,670,146 I295N probably damaging Het
Oprm1 T C 10: 6,839,544 S390P probably benign Het
Pcdhb14 T C 18: 37,449,662 L607P probably damaging Het
Rap1gds1 A T 3: 138,965,960 I133N probably damaging Het
Rasl10a T C 11: 5,059,461 L83S probably damaging Het
Satb2 C T 1: 56,845,620 V382M probably damaging Het
Sh3gl1 T C 17: 56,018,949 K160R probably damaging Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spef2 A G 15: 9,704,536 I454T probably damaging Het
Stag3 A G 5: 138,298,349 K490E probably benign Het
Tctn3 T C 19: 40,611,711 K95R probably benign Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Ttc21a A T 9: 119,954,165 E511V probably damaging Het
Ttn A G 2: 76,711,888 F25258L probably damaging Het
Ttn A C 2: 76,808,946 C13828G probably damaging Het
Vmn1r210 T A 13: 22,827,403 M238L probably damaging Het
Vmn1r38 A G 6: 66,776,907 I75T probably benign Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwa7 T C 17: 35,025,159 probably null Het
Zfp128 T A 7: 12,884,732 D52E probably damaging Het
Zfp618 T C 4: 63,115,491 probably benign Het
Zkscan2 T A 7: 123,485,002 E633V possibly damaging Het
Other mutations in Tdgf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Tdgf1 APN 9 110942623 missense probably damaging 1.00
IGL03037:Tdgf1 APN 9 110943220 missense probably benign 0.23
R1171:Tdgf1 UTSW 9 110943167 missense probably benign 0.37
R4012:Tdgf1 UTSW 9 110940713 missense probably benign
R5488:Tdgf1 UTSW 9 110943197 missense probably benign 0.01
R5955:Tdgf1 UTSW 9 110944213 missense unknown
R6536:Tdgf1 UTSW 9 110944189 critical splice donor site probably null
R7624:Tdgf1 UTSW 9 110945949 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGACTATCAGGGACATTCC -3'
(R):5'- AGTGTGGAGACCTTTGGCAAG -3'

Sequencing Primer
(F):5'- ATGCCTCACTCACTTTTATGACAAG -3'
(R):5'- GAGACCTTTGGCAAGCACCAC -3'
Posted On2015-03-25