Mutagenetix > Incidental Mutation

Incidental Mutation 'R3792:Mroh2b'

272605

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R3792 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 4923620 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Leucine at position 612 (W612L)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

AlphaFold

Q7M6Y6

Predicted Effect

probably damaging
Transcript: ENSMUST00000045736
AA Change: W612L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: W612L

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930595M18Rik	A	G	X: 81,420,817	V428A	probably benign	Het
Aanat	T	C	11: 116,596,231	L88P	probably damaging	Het
Arhgap5	A	T	12: 52,519,888	N1214I	probably benign	Het
BC034090	A	T	1: 155,241,797	S192T	probably damaging	Het
Bco1	G	A	8: 117,130,676	V461I	possibly damaging	Het
Cass4	C	T	2: 172,432,558	P753L	probably damaging	Het
Cubn	G	A	2: 13,427,914	R1199C	probably damaging	Het
Dcaf12l1	T	C	X: 44,788,436	N495S	possibly damaging	Het
Dopey2	C	A	16: 93,771,846	Q1599K	possibly damaging	Het
Dyrk1a	C	A	16: 94,685,074	L427I	probably benign	Het
Esp16	T	C	17: 39,537,848	I11T	possibly damaging	Het
Esyt3	A	T	9: 99,315,281	F832Y	possibly damaging	Het
F8	A	T	X: 75,285,365		probably null	Het
Fam135a	T	C	1: 24,028,311	Y259C	probably benign	Het
Fbxo38	T	C	18: 62,533,462		probably null	Het
Fbxo43	T	C	15: 36,162,859	I67M	probably benign	Het
Gcfc2	G	T	6: 81,930,767	C154F	probably benign	Het
Gm21731	G	T	13: 120,240,931	V88F	probably damaging	Het
Hipk2	C	T	6: 38,698,556	R1029H	probably damaging	Het
Ilk	G	A	7: 105,742,087	W73*	probably null	Het
Ism1	T	C	2: 139,740,253	S162P	probably damaging	Het
Itpkb	T	A	1: 180,333,173	L288Q	possibly damaging	Het
Itpr2	C	A	6: 146,415,354	K306N	probably damaging	Het
Kdm2a	C	T	19: 4,324,512	E864K	possibly damaging	Het
Kdm4b	G	A	17: 56,355,944	V172M	probably damaging	Het
Kyat3	A	T	3: 142,737,844	K406M	probably null	Het
Lipe	T	A	7: 25,397,620	K299N	possibly damaging	Het
Lrrc2	T	A	9: 110,966,517	C123*	probably null	Het
Mptx2	T	A	1: 173,274,673	I150F	probably damaging	Het
Mucl2	T	C	15: 103,898,426	T27A	possibly damaging	Het
Nfx1	T	A	4: 41,004,357	C709*	probably null	Het
Olfr164	A	G	16: 19,285,946	S266P	possibly damaging	Het
Olfr624	A	T	7: 103,670,146	I295N	probably damaging	Het
Oprm1	T	C	10: 6,839,544	S390P	probably benign	Het
Pcdhb14	T	C	18: 37,449,662	L607P	probably damaging	Het
Rap1gds1	A	T	3: 138,965,960	I133N	probably damaging	Het
Rasl10a	T	C	11: 5,059,461	L83S	probably damaging	Het
Satb2	C	T	1: 56,845,620	V382M	probably damaging	Het
Sh3gl1	T	C	17: 56,018,949	K160R	probably damaging	Het
Sirt4	T	C	5: 115,480,292	D241G	probably benign	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Spef2	A	G	15: 9,704,536	I454T	probably damaging	Het
Stag3	A	G	5: 138,298,349	K490E	probably benign	Het
Tctn3	T	C	19: 40,611,711	K95R	probably benign	Het
Tdgf1	C	T	9: 110,943,190	R46Q	probably benign	Het
Trp53bp1	T	C	2: 121,200,329	I1784V	probably damaging	Het
Ttc21a	A	T	9: 119,954,165	E511V	probably damaging	Het
Ttn	A	G	2: 76,711,888	F25258L	probably damaging	Het
Ttn	A	C	2: 76,808,946	C13828G	probably damaging	Het
Vmn1r210	T	A	13: 22,827,403	M238L	probably damaging	Het
Vmn1r38	A	G	6: 66,776,907	I75T	probably benign	Het
Vmn2r84	T	A	10: 130,385,800	*850C	probably null	Het
Vwa7	T	C	17: 35,025,159		probably null	Het
Zfp128	T	A	7: 12,884,732	D52E	probably damaging	Het
Zfp618	T	C	4: 63,115,491		probably benign	Het
Zkscan2	T	A	7: 123,485,002	E633V	possibly damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
R8728:Mroh2b	UTSW	15	4905640	missense	probably damaging	1.00
R8747:Mroh2b	UTSW	15	4935300	missense	probably damaging	0.99
R8798:Mroh2b	UTSW	15	4948709	missense	probably damaging	1.00
R8814:Mroh2b	UTSW	15	4941625	missense	possibly damaging	0.61
R8856:Mroh2b	UTSW	15	4931028	nonsense	probably null
R8910:Mroh2b	UTSW	15	4931373	missense	probably benign	0.01
R8913:Mroh2b	UTSW	15	4917528	intron	probably benign
R8941:Mroh2b	UTSW	15	4962124	missense	possibly damaging	0.86
R9014:Mroh2b	UTSW	15	4899188	start codon destroyed	probably null	0.95
R9086:Mroh2b	UTSW	15	4953272	critical splice acceptor site	probably null
R9101:Mroh2b	UTSW	15	4900453	missense	probably benign	0.20
R9118:Mroh2b	UTSW	15	4962091	missense	possibly damaging	0.86
R9393:Mroh2b	UTSW	15	4951184	missense	probably benign
R9429:Mroh2b	UTSW	15	4934425	missense	probably damaging	1.00
R9431:Mroh2b	UTSW	15	4934470	missense	probably damaging	1.00
R9443:Mroh2b	UTSW	15	4944339	missense	probably damaging	1.00
R9447:Mroh2b	UTSW	15	4931341	missense	probably damaging	1.00
R9497:Mroh2b	UTSW	15	4921363	missense	probably damaging	0.98
R9588:Mroh2b	UTSW	15	4948648	missense	probably benign	0.00
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCCAGTAAAGACAGAGCC -3'
(R):5'- ACAGACCAGGATTGTTCCAAGG -3'

Sequencing Primer
(F):5'- AGAGCCTGAAAGAAATGCTCTC -3'
(R):5'- CAGACCAGGATTGTTCCAAGGTTTTG -3'

Posted On

2015-03-25