Mutagenetix > Incidental Mutations

Incidental Mutation 'R3792:Spef2'

272606

Institutional Source

Beutler Lab

Gene Symbol

Spef2

Ensembl Gene

ENSMUSG00000072663

Gene Name

sperm flagellar 2

Synonyms

C230086A09Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.129) question?

Stock #

R3792 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

9578193-9748868 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9704536 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 454 (I454T)

Ref Sequence

ENSEMBL: ENSMUSP00000124393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000159368] [ENSMUST00000160236] [ENSMUST00000162780] [ENSMUST00000208854]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041840
AA Change: I397T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: I397T

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	161	2.8e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	829	5.9e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159093
AA Change: I454T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663
AA Change: I454T

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	166	3.5e-57	PFAM
coiled coil region	167	205	N/A	INTRINSIC
low complexity region	208	220	N/A	INTRINSIC
coiled coil region	228	260	N/A	INTRINSIC
low complexity region	304	313	N/A	INTRINSIC
coiled coil region	369	402	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159288
AA Change: I397T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125336
Gene: ENSMUSG00000072663
AA Change: I397T

Domain	Start	End	E-Value	Type
Pfam:CH_2	5	102	3.1e-25	PFAM
low complexity region	106	115	N/A	INTRINSIC
low complexity region	137	148	N/A	INTRINSIC
low complexity region	151	163	N/A	INTRINSIC
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	602	789	8.8e-11	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1221	N/A	INTRINSIC
low complexity region	1264	1278	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
SCOP:d1rec__	1378	1530	3e-3	SMART
low complexity region	1605	1624	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159368
AA Change: I397T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124723
Gene: ENSMUSG00000072663
AA Change: I397T

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	162	1.4e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000160236
AA Change: I397T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: I397T

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	160	4.6e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	787	3.7e-10	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1225	N/A	INTRINSIC
low complexity region	1254	1268	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
SCOP:d1rec__	1368	1520	3e-3	SMART
low complexity region	1595	1614	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162780
AA Change: I454T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124393
Gene: ENSMUSG00000072663
AA Change: I454T

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	164	1.1e-57	PFAM
coiled coil region	167	205	N/A	INTRINSIC
low complexity region	208	220	N/A	INTRINSIC
coiled coil region	228	260	N/A	INTRINSIC
low complexity region	304	313	N/A	INTRINSIC
coiled coil region	369	402	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208854
AA Change: I397T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930595M18Rik	A	G	X: 81,420,817	V428A	probably benign	Het
Aanat	T	C	11: 116,596,231	L88P	probably damaging	Het
Arhgap5	A	T	12: 52,519,888	N1214I	probably benign	Het
BC034090	A	T	1: 155,241,797	S192T	probably damaging	Het
Bco1	G	A	8: 117,130,676	V461I	possibly damaging	Het
Cass4	C	T	2: 172,432,558	P753L	probably damaging	Het
Cubn	G	A	2: 13,427,914	R1199C	probably damaging	Het
Dcaf12l1	T	C	X: 44,788,436	N495S	possibly damaging	Het
Dopey2	C	A	16: 93,771,846	Q1599K	possibly damaging	Het
Dyrk1a	C	A	16: 94,685,074	L427I	probably benign	Het
Esp16	T	C	17: 39,537,848	I11T	possibly damaging	Het
Esyt3	A	T	9: 99,315,281	F832Y	possibly damaging	Het
F8	A	T	X: 75,285,365		probably null	Het
Fam135a	T	C	1: 24,028,311	Y259C	probably benign	Het
Fbxo38	T	C	18: 62,533,462		probably null	Het
Fbxo43	T	C	15: 36,162,859	I67M	probably benign	Het
Gcfc2	G	T	6: 81,930,767	C154F	probably benign	Het
Gm21731	G	T	13: 120,240,931	V88F	probably damaging	Het
Hipk2	C	T	6: 38,698,556	R1029H	probably damaging	Het
Ilk	G	A	7: 105,742,087	W73*	probably null	Het
Ism1	T	C	2: 139,740,253	S162P	probably damaging	Het
Itpkb	T	A	1: 180,333,173	L288Q	possibly damaging	Het
Itpr2	C	A	6: 146,415,354	K306N	probably damaging	Het
Kdm2a	C	T	19: 4,324,512	E864K	possibly damaging	Het
Kdm4b	G	A	17: 56,355,944	V172M	probably damaging	Het
Kyat3	A	T	3: 142,737,844	K406M	probably null	Het
Lipe	T	A	7: 25,397,620	K299N	possibly damaging	Het
Lrrc2	T	A	9: 110,966,517	C123*	probably null	Het
Mptx2	T	A	1: 173,274,673	I150F	probably damaging	Het
Mroh2b	G	T	15: 4,923,620	W612L	probably damaging	Het
Mucl2	T	C	15: 103,898,426	T27A	possibly damaging	Het
Nfx1	T	A	4: 41,004,357	C709*	probably null	Het
Olfr164	A	G	16: 19,285,946	S266P	possibly damaging	Het
Olfr624	A	T	7: 103,670,146	I295N	probably damaging	Het
Oprm1	T	C	10: 6,839,544	S390P	probably benign	Het
Pcdhb14	T	C	18: 37,449,662	L607P	probably damaging	Het
Rap1gds1	A	T	3: 138,965,960	I133N	probably damaging	Het
Rasl10a	T	C	11: 5,059,461	L83S	probably damaging	Het
Satb2	C	T	1: 56,845,620	V382M	probably damaging	Het
Sh3gl1	T	C	17: 56,018,949	K160R	probably damaging	Het
Sirt4	T	C	5: 115,480,292	D241G	probably benign	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Stag3	A	G	5: 138,298,349	K490E	probably benign	Het
Tctn3	T	C	19: 40,611,711	K95R	probably benign	Het
Tdgf1	C	T	9: 110,943,190	R46Q	probably benign	Het
Trp53bp1	T	C	2: 121,200,329	I1784V	probably damaging	Het
Ttc21a	A	T	9: 119,954,165	E511V	probably damaging	Het
Ttn	A	G	2: 76,711,888	F25258L	probably damaging	Het
Ttn	A	C	2: 76,808,946	C13828G	probably damaging	Het
Vmn1r210	T	A	13: 22,827,403	M238L	probably damaging	Het
Vmn1r38	A	G	6: 66,776,907	I75T	probably benign	Het
Vmn2r84	T	A	10: 130,385,800	*850C	probably null	Het
Vwa7	T	C	17: 35,025,159		probably null	Het
Zfp128	T	A	7: 12,884,732	D52E	probably damaging	Het
Zfp618	T	C	4: 63,115,491		probably benign	Het
Zkscan2	T	A	7: 123,485,002	E633V	possibly damaging	Het

Other mutations in Spef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Spef2	APN	15	9740535	missense	probably damaging	1.00
IGL00886:Spef2	APN	15	9663095	missense	probably damaging	1.00
IGL01409:Spef2	APN	15	9716413	missense	probably damaging	1.00
IGL01413:Spef2	APN	15	9676290	missense	probably benign	0.16
IGL01474:Spef2	APN	15	9663158	missense	probably benign	0.00
IGL01603:Spef2	APN	15	9704380	missense	probably damaging	0.99
IGL02320:Spef2	APN	15	9717576	missense	probably damaging	0.99
IGL02570:Spef2	APN	15	9717498	nonsense	probably null
IGL02605:Spef2	APN	15	9725152	missense	probably damaging	0.99
IGL02890:Spef2	APN	15	9748767	start codon destroyed	probably null	1.00
IGL02904:Spef2	APN	15	9679346	missense	probably damaging	1.00
IGL02942:Spef2	APN	15	9668874	missense	possibly damaging	0.71
IGL02953:Spef2	APN	15	9713243	missense	possibly damaging	0.82
IGL02965:Spef2	APN	15	9725106	splice site	probably benign
IGL03263:Spef2	APN	15	9667219	missense	possibly damaging	0.72
IGL03302:Spef2	APN	15	9676380	missense	probably benign	0.01
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0101:Spef2	UTSW	15	9713108	missense	probably damaging	1.00
R0183:Spef2	UTSW	15	9716359	missense	possibly damaging	0.70
R0386:Spef2	UTSW	15	9584062	missense	probably damaging	1.00
R0511:Spef2	UTSW	15	9583984	critical splice donor site	probably null
R0617:Spef2	UTSW	15	9592758	missense	probably damaging	1.00
R0655:Spef2	UTSW	15	9626131	missense	possibly damaging	0.96
R0829:Spef2	UTSW	15	9687813	missense	probably benign	0.10
R0908:Spef2	UTSW	15	9614195	splice site	probably null
R0939:Spef2	UTSW	15	9704550	splice site	probably null
R0973:Spef2	UTSW	15	9716396	missense	probably damaging	1.00
R1371:Spef2	UTSW	15	9725108	splice site	probably benign
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1392:Spef2	UTSW	15	9647263	missense	probably benign	0.15
R1428:Spef2	UTSW	15	9596707	unclassified	probably benign
R1518:Spef2	UTSW	15	9667230	missense	probably damaging	1.00
R1585:Spef2	UTSW	15	9596574	missense	probably damaging	1.00
R1654:Spef2	UTSW	15	9634652	missense	probably damaging	0.99
R1723:Spef2	UTSW	15	9614209	missense	probably damaging	1.00
R1757:Spef2	UTSW	15	9717482	missense	probably damaging	1.00
R1812:Spef2	UTSW	15	9679349	missense	probably damaging	1.00
R1817:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1818:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1873:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9584108	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9597401	missense	possibly damaging	0.78
R1897:Spef2	UTSW	15	9729654	nonsense	probably null
R1901:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1902:Spef2	UTSW	15	9607377	missense	probably damaging	1.00
R1943:Spef2	UTSW	15	9663194	missense	possibly damaging	0.76
R1968:Spef2	UTSW	15	9609516	missense	probably damaging	1.00
R1973:Spef2	UTSW	15	9663066	makesense	probably null
R1998:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R1999:Spef2	UTSW	15	9668903	critical splice acceptor site	probably null
R2008:Spef2	UTSW	15	9713185	missense	possibly damaging	0.95
R2111:Spef2	UTSW	15	9589573	missense	probably damaging	1.00
R2127:Spef2	UTSW	15	9729661	missense	possibly damaging	0.53
R2405:Spef2	UTSW	15	9626034	nonsense	probably null
R2517:Spef2	UTSW	15	9725197	missense	possibly damaging	0.93
R2889:Spef2	UTSW	15	9630613	missense	probably damaging	0.99
R2988:Spef2	UTSW	15	9682623	missense	probably benign	0.43
R4154:Spef2	UTSW	15	9626021	missense	probably benign	0.13
R4159:Spef2	UTSW	15	9676321	missense	probably damaging	1.00
R4199:Spef2	UTSW	15	9667280	missense	probably damaging	1.00
R4320:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4321:Spef2	UTSW	15	9679343	missense	possibly damaging	0.93
R4568:Spef2	UTSW	15	9647217	missense	probably damaging	1.00
R4625:Spef2	UTSW	15	9647438	missense	probably damaging	1.00
R4669:Spef2	UTSW	15	9676373	missense	probably benign	0.42
R4684:Spef2	UTSW	15	9647490	missense	probably benign	0.44
R4761:Spef2	UTSW	15	9652954	missense	probably damaging	1.00
R4839:Spef2	UTSW	15	9713178	nonsense	probably null
R5004:Spef2	UTSW	15	9578327	missense	probably benign	0.02
R5157:Spef2	UTSW	15	9668791	nonsense	probably null
R5230:Spef2	UTSW	15	9667230	missense	possibly damaging	0.62
R5315:Spef2	UTSW	15	9596691	missense	probably damaging	0.98
R5400:Spef2	UTSW	15	9614281	missense	probably damaging	1.00
R5591:Spef2	UTSW	15	9583836	missense	probably benign	0.02
R5599:Spef2	UTSW	15	9729703	missense	possibly damaging	0.53
R5605:Spef2	UTSW	15	9609520	missense	probably damaging	0.96
R5787:Spef2	UTSW	15	9748726	missense	possibly damaging	0.91
R5939:Spef2	UTSW	15	9614215	missense	probably benign	0.16
R6177:Spef2	UTSW	15	9727532	missense	possibly damaging	0.89
R6641:Spef2	UTSW	15	9625973	missense	probably damaging	1.00
R6665:Spef2	UTSW	15	9600518	critical splice donor site	probably null
R6944:Spef2	UTSW	15	9592749	missense	probably damaging	1.00
R6956:Spef2	UTSW	15	9684935	missense	probably damaging	1.00
R6968:Spef2	UTSW	15	9597340	missense	probably benign	0.02
R7089:Spef2	UTSW	15	9725171	missense	probably damaging	1.00
R7117:Spef2	UTSW	15	9729838	missense	probably damaging	1.00
R7161:Spef2	UTSW	15	9717603	missense	probably benign	0.29
R7223:Spef2	UTSW	15	9601640	missense	unknown
R7263:Spef2	UTSW	15	9653012	synonymous	probably null
R7270:Spef2	UTSW	15	9599980	critical splice donor site	probably null
R7303:Spef2	UTSW	15	9647490	missense	possibly damaging	0.92
R7369:Spef2	UTSW	15	9584207	missense	probably benign	0.02
R7464:Spef2	UTSW	15	9740585	missense	probably benign	0.23
R7498:Spef2	UTSW	15	9727539	missense	probably benign
R7587:Spef2	UTSW	15	9713219	missense	probably damaging	1.00
R7748:Spef2	UTSW	15	9652945	missense	probably damaging	0.98
R7772:Spef2	UTSW	15	9704481	missense	probably damaging	0.99
X0025:Spef2	UTSW	15	9596622	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATGTACATGAATTAACCCAGGAG -3'
(R):5'- CTGGCATTGTACACGTGATAATCC -3'

Sequencing Primer
(F):5'- TACATGAATTAACCCAGGAGAGAGTG -3'
(R):5'- CAAATTAAGGGCAGTCACC -3'

Posted On

2015-03-25