Incidental Mutation 'R3792:F8'
ID272622
Institutional Source Beutler Lab
Gene Symbol F8
Ensembl Gene ENSMUSG00000031196
Gene Namecoagulation factor VIII
SynonymsFVIII, Cf8, Factor VIII, Cf-8
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.418) question?
Stock #R3792 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location75172715-75382615 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 75285365 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033539] [ENSMUST00000114085]
Predicted Effect probably null
Transcript: ENSMUST00000033539
SMART Domains Protein: ENSMUSP00000033539
Gene: ENSMUSG00000031196

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Cu-oxidase_3 89 203 3.6e-7 PFAM
low complexity region 359 377 N/A INTRINSIC
Pfam:Cu-oxidase_3 444 577 8.8e-7 PFAM
low complexity region 1210 1231 N/A INTRINSIC
low complexity region 1268 1278 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
internal_repeat_1 1683 2005 3.96e-46 PROSPERO
FA58C 2007 2156 7.3e-48 SMART
FA58C 2160 2313 2.36e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114085
SMART Domains Protein: ENSMUSP00000109719
Gene: ENSMUSG00000031196

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Cu-oxidase_3 89 203 3.1e-7 PFAM
low complexity region 359 377 N/A INTRINSIC
Pfam:Cu-oxidase_3 446 577 7.4e-7 PFAM
low complexity region 1140 1161 N/A INTRINSIC
low complexity region 1198 1208 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
internal_repeat_2 1613 1838 3.99e-33 PROSPERO
internal_repeat_1 1615 1935 1.02e-41 PROSPERO
FA58C 1937 2086 7.3e-48 SMART
FA58C 2090 2243 2.36e-24 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male hemizygotes and female homozygotes for targeted null mutations produce no factor VIII, but are apparently healthy and fertile. However, affected mice show prolonged, exsanguinating bleeding following tail-clipping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik A G X: 81,420,817 V428A probably benign Het
Aanat T C 11: 116,596,231 L88P probably damaging Het
Arhgap5 A T 12: 52,519,888 N1214I probably benign Het
BC034090 A T 1: 155,241,797 S192T probably damaging Het
Bco1 G A 8: 117,130,676 V461I possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cubn G A 2: 13,427,914 R1199C probably damaging Het
Dcaf12l1 T C X: 44,788,436 N495S possibly damaging Het
Dopey2 C A 16: 93,771,846 Q1599K possibly damaging Het
Dyrk1a C A 16: 94,685,074 L427I probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
Fam135a T C 1: 24,028,311 Y259C probably benign Het
Fbxo38 T C 18: 62,533,462 probably null Het
Fbxo43 T C 15: 36,162,859 I67M probably benign Het
Gcfc2 G T 6: 81,930,767 C154F probably benign Het
Gm21731 G T 13: 120,240,931 V88F probably damaging Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Ilk G A 7: 105,742,087 W73* probably null Het
Ism1 T C 2: 139,740,253 S162P probably damaging Het
Itpkb T A 1: 180,333,173 L288Q possibly damaging Het
Itpr2 C A 6: 146,415,354 K306N probably damaging Het
Kdm2a C T 19: 4,324,512 E864K possibly damaging Het
Kdm4b G A 17: 56,355,944 V172M probably damaging Het
Kyat3 A T 3: 142,737,844 K406M probably null Het
Lipe T A 7: 25,397,620 K299N possibly damaging Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Mptx2 T A 1: 173,274,673 I150F probably damaging Het
Mroh2b G T 15: 4,923,620 W612L probably damaging Het
Mucl2 T C 15: 103,898,426 T27A possibly damaging Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Olfr164 A G 16: 19,285,946 S266P possibly damaging Het
Olfr624 A T 7: 103,670,146 I295N probably damaging Het
Oprm1 T C 10: 6,839,544 S390P probably benign Het
Pcdhb14 T C 18: 37,449,662 L607P probably damaging Het
Rap1gds1 A T 3: 138,965,960 I133N probably damaging Het
Rasl10a T C 11: 5,059,461 L83S probably damaging Het
Satb2 C T 1: 56,845,620 V382M probably damaging Het
Sh3gl1 T C 17: 56,018,949 K160R probably damaging Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spef2 A G 15: 9,704,536 I454T probably damaging Het
Stag3 A G 5: 138,298,349 K490E probably benign Het
Tctn3 T C 19: 40,611,711 K95R probably benign Het
Tdgf1 C T 9: 110,943,190 R46Q probably benign Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Ttc21a A T 9: 119,954,165 E511V probably damaging Het
Ttn A G 2: 76,711,888 F25258L probably damaging Het
Ttn A C 2: 76,808,946 C13828G probably damaging Het
Vmn1r210 T A 13: 22,827,403 M238L probably damaging Het
Vmn1r38 A G 6: 66,776,907 I75T probably benign Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwa7 T C 17: 35,025,159 probably null Het
Zfp128 T A 7: 12,884,732 D52E probably damaging Het
Zfp618 T C 4: 63,115,491 probably benign Het
Zkscan2 T A 7: 123,485,002 E633V possibly damaging Het
Other mutations in F8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:F8 APN X 75334180 unclassified probably benign
IGL01079:F8 APN X 75286618 missense probably damaging 0.98
IGL01101:F8 APN X 75287387 missense possibly damaging 0.62
IGL01160:F8 APN X 75288061 missense probably damaging 0.99
IGL01397:F8 APN X 75379539 missense probably benign
IGL02043:F8 APN X 75332641 missense probably benign 0.00
IGL02479:F8 APN X 75288240 missense probably damaging 0.98
IGL02505:F8 APN X 75379598 intron probably benign
IGL02869:F8 APN X 75287381 missense probably benign 0.00
IGL03004:F8 APN X 75212052 missense probably damaging 1.00
R0657:F8 UTSW X 75211416 missense possibly damaging 0.86
R0699:F8 UTSW X 75379624 intron probably benign
R2035:F8 UTSW X 75322998 frame shift probably null
R2037:F8 UTSW X 75322998 frame shift probably null
R3436:F8 UTSW X 75267424 splice site probably benign
R3735:F8 UTSW X 75211375 missense probably damaging 1.00
R3736:F8 UTSW X 75211375 missense probably damaging 1.00
X0009:F8 UTSW X 75287783 missense probably benign 0.36
Z1088:F8 UTSW X 75323149 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACAGTGACCTGATGTGTGAAAG -3'
(R):5'- AAGCAACTGACTATGATGATGCC -3'

Sequencing Primer
(F):5'- ACCTGATGTGTGAAAGTGGGG -3'
(R):5'- GATGATGCCATCACCATTGAAAC -3'
Posted On2015-03-25